IntroductionTop

The availability of feed sources for ruminant production in the tropics are turning to be challenging mostly because of increasing costs and limited supplies of conventional feedstuffs such as alfalfa, corn and other traditional feed ingredients (Jafari et al., 2015). Tree leaves are an important source of supplementary protein, vitamins and minerals in developing countries that are widely used in the tropics and offer the opportunity to use as nitrogen and energy supplements to livestock where agricultural primary products are limited (Cherdthong et al., 2010). Moreover, tree leaves contain different classes of bioactive compounds such as tannins, saponins, flavonoids and many other plant secondary metabolites which have been shown to potentially improve rumen microbial fermentation (Patra & Saxena, 2011). Tropical plants normally contain different spectrum of secondary compounds (Wanapat et al., 2013). Papaya (Carica papaya) leaf (PL) has high protein contents and is low in fiber (Jayanegara et al., 2013), and can be found in all tropical countries and many subtropical regions of the world. Ayoola & Adeyeye (2010) indicated that PL served as a dual-purpose agent containing essential nutrients and broad spectrum of bioactive compounds such as tannins, saponins, cardiac glycoside and alkaloids. The highest amount of phenolic compound has also been exhibited in PL among other parts of papaya (e.g. unripe papaya fruit, ripe papaya fruit and seed) (Maisarah et al., 2014). Improved rumen fermentation characteristics and reduced population of rumen methanogenic archea were observed after 24 h of in vitro incubation by using PL, PL methanolic extract and PL different solvent extracts in previous studies (Jafari et al., 2016 a,b).

Vasta et al. (2009) and Buccioni et al. (2017) reported that tannin supplementation favored the accumulation of polyunsaturated fatty acid (PUFA) and reduced the accumulation of saturated fatty acid (SFA) in the blood of sheep. However, there are no previous reports on the effects of PL on rumen fermentation characteristics, microbial population and blood fatty acid (FA) parameters in an in vivo assay.

Therefore, we hypothesized that the addition of different dietary levels of PL would have modulatory effects on rumen fermentation characteristics, blood FA composition and inhibitory effects on the population of rumen methanogenic archaea and protozoa when tested in vivo.

Material and methodsTop

Experimental animals and diets

The PL samples were collected from a papaya farm (1º34'57.7" N, 104º12'20.7" E) in Kota Tinggi, Johor, Malaysia. The PL samples at the phenological stage of recently matured and harvestable vegetative stage were air-dried for 2 days, followed by oven-drying overnight at 50ºC. After drying, the samples were chopped and stored in tightly closed plastic bags before the feeding trial. The experiment was conducted at the research farm of the Faculty of Veterinary Medicine, Universiti Putra Malaysia. Three Kacang crossbred male goats, each fitted with rumen fistulae, were used for the study. The body weight of goats was 39.0 ± 0.70 kg (mean ± SE). The goats were housed in individual pens with metal slotted flooring, raised above the ground. The care of the experimental goats was in accordance with the Animal Care and Use Committee of Universiti Putra Malaysia. Three experimental diets in a 3×3 latin square design were used for this study. Experiments were conducted for three periods, and each period lasted for 21 d. There was 7 days of wash-out interval between each period to minimize the carry over effect among treatments. The dietary treatments were: basal diet with no inclusion of PL (CON: 50% alfalfa hay + 50% concentrate), 25% of alfalfa hay in basal diet replaced by PL (medium PL: MPL) and 50% of alfalfa hay in basal diet replaced by PL (high PL: HPL). The diet was fed at a rate of 3% of body weight for maintenance requirements according to NRC (2007). Animals were fed twice a day at approximately 08:00 and 17:00. and had ad libitum access to fresh water.

Chemical composition of experimental diets

The experimental diets were dried at 60ºC for 48 h in an air oven, and ground in a Wiley Mill (A. H. Thomas Co., Philadelphia, PA, USA) through a 1-mm screen. Sample diets were analyzed according to AOAC (1990) for dry matter (DM), crude protein (CP), ether extract (EE) and ash.

Neutral detergent fiber (NDF) and acid detergent fiber (ADF) were analyzed according to Van Soest et al. (1991). The analysis of NDF was conducted without sodium sulfite and with the use of a heat stable a-amylase. The chemical composition and fatty acid content of the experimental diets are shown in Table 1.

Rumen and blood sample collection and laboratory analysis

Rumen content samples (50 mL) were collected from different parts of the rumen at the last day of feeding trial (third week) at 0, 2, 4, 6 and 8 h post morning feeding. Rumen contents were sampled for determination of pH (Mettler-Toledo Ltd, England), NH3N, total volatile fatty acids (VFAs) and for the quantification of microbial populations (methanogenic archea and protozoa). The rumen samples were strained through four layers of cheesecloth. One mL of strained sample was immediately snapped frozen at - 80ºC for microbial analyses.

The samples were then acidified with 25% metaphosphoric acid and centrifuged (10 min, 4ºC at 15,000 × g), filtered, and the filtrate was used for determination of NH3N and VFAs. The concentration of NH3N was determined using the colorimetric method as described by Jafari et al. (2016a). The total VFAs (TVFA) were determined using an Agilent 7890A gas-liquid chromatography (Agilent Technologies, Palo Alto, CA, USA) equipped with a flame ionization detector (FID).

An internal standard (4-methyl-n-valeric acid) was used for VFA determination. Blood samples were taken at 8 h post morning feeding for determination of blood plasma FAs, biochemical analyses and antioxidant activity. Blood samples (about 10 mL) were collected from the jugular vein into tubes containing 12 mg of EDTA and plasma was separated by centrifugation at 500 × g for 10 min at 4°C and stored at -20°C until analysis.

Fatty acid profile in experimental diets and blood plasma

The FAs in experimental diets and blood plasma (1 mL) were extracted based on the protocol of Ebrahimi et al. (2015) as described by Jafari et al. (2016a) using chloroform/methanol 2:1 (v/v). An internal standard, heneicosanoic acid (Sigma Chemical, St. Louis, MO, USA), was added to each sample before transmethylation to determine the individual FA concentration within the sample. Individual FAs were determined by gas chromatography (Agilent 7890A), using a Supelco SP 2560 capillary column of 100 m × 0.25 mm ID × 0.2 µm film thickness (Supelco, Bellefonte, PA, USA). The FAs concentrations were expressed as g/100 g of identified FA. Reference standards (mix C4 - C24 methyl esters; Sigma-Aldrich, Inc., St. Louis, MO, USA) and conjugated linoleic acid (CLA) standard mix (c9, t11 and t10, c12 CLA, Sigma-Aldrich, Inc., St. Louis, MO, USA) were used to determine recoveries and correction factors for determination of individual FA.

Rumen microbial quantification by real time polymerase chain reaction (PCR)

The DNA was extracted from the rumen fluid using QIAamp DNA Stool Mini Kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s protocol. The extracted DNA was stored at -20°C until used. Purity and concentration of genomic DNA in each sample were measured using a spectrophotometer and the number of copies of a template DNA per mL of elution buffer was calculated using the following formula (Genomics and Sequencing Center web-based calculator, http://cels.uri.edu/gsc/cndna.html).

Standard curves were constructed using amplification cycle threshold (CT) values that were obtained from a serial dilution of DNA of each bacterial group.

Primers used to quantify the population of the different groups of microorganisms were:

Total methanogen (F, TTCGGTGGATCDCARAGRGC; R, GBARGTCGWAWCCGTAGAATCC) (Zhang et al., 2008) and total protozoa (F, ACCGCATAAGCGCACGGA; R, CGGGTCCATCTTGTACCGATAAAT) (Sylvester et al., 2004). Real-time PCR was performed using the Bio-Rad CFX96 Touch (Bio-Rad Laboratories, Hercules, CA, USA) using optical grade plates. The PCR reaction was performed on a total volume of 25 µL using the iQTMSYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA). Each reaction included 12.5 µL SYBR Green Supermix, 1 µL of each primer, 1 µL of DNA samples and 9.5 µL RNAse free water. To confirm the specificity of amplification, a melting curve analysis was carried out after the last cycle of each amplification.

Blood biochemical parameters and antioxidant activity

Blood plasma levels of glucose, urea N, uric acid, total protein, cholesterol, triglycerides, high density lipoprotein (HDL) and low density lipoprotein (LDL) were measured using analytical kits (Pointe Scientific Inc., MI, USA) and determined calorimetrically on a Hitachi 902 Automatic chemical analyzer (Roche International, Basel, Switzerland).

Malonaldehyde (MDA) concentration was determined by the thiobarbituric acid reactive substance method as described by Tug et al. (2005). In brief, the proteins in 0.15 mL blood plasma were first precipitated by using sulphuric and phosphotungstic acid and then the levels of MDA in the samples were measured by using Shimadzu UV-1201V spectrophotometer (Shimadzu, Kyoto, Japan) at 532 nm. Different concentrations of tetraethoxypropane (1, 1, 3, 3- ) were used as standard MDA to plot a standard curve.

Statistical analysis

Data of rumen fermentation characteristics, microbial population and blood biochemical parameters were analyzed using the GLM procedure of SAS (2003).

Sampling at different times (0, 2, 4, 6 and 8 h) was analyzed using repeated measures. The microbial data were normalized using the log10-transformation prior the statistical analysis. Multiple comparison of the means among treatments was performed using the Duncan's test. Values of p<0.05 were considered significant.

ResultsTop

Rumen fermentation parameters

The effects of PL supplementation on rumen fermentation parameters are shown in Table 2. In terms of pH and at different hours of measurement (0, 2, 4, 6 and 8 h), 0 h had the highest pH value among the treatments (6.85, 7.18 and 6.54 for CON, MPL and HPL, respectively) whilst 2 h post morning feeding showed the lowest values (6.19, 6.48 and 6.16 for CON, MPL and HPL, respectively). There were significant differences (p<0. 05) in pH among the treatment being at 0 h the highest value for MPL (7.18), followed by CON (6.85) and HPL (6.54), respectively. The lowest pH value was recorded for HPL at 6 h (6.48) and 8 h (6.47) post morning feeding.

In regards to concentration of NH3N, except for 8 h after feeding, there were significant differences for all sampling times among treatments. The highest concentration of NH3N corresponded to CON at 0, 2, 4 and 6 h (13.92, 13.07, 12.83 and 14.60 mg/dL, respectively). Between the times of measurement for HPL, NH3N concentration was highest at 4 h (12.98 mg/dL) and lowest at 0 h (9.79 mg/dL).

No reduction in the concentration of TVFA (mmol/L) in all PL treatment groups was observed as compared with CON at all times. The highest (p<0.05) concentration of TVFA was recorded for HPL as compared to CON at all times of measurements except at 2h of measurement which was not significantly different among the treatments (p>0.05).

Fatty acid composition in blood plasma

The FA profiles of blood plasma at 8 h of measurement are shown in Table 3. The concentration (g/100 g FA) of C18:0 was significantly lower (p<0.05) in HPL (14.8) compared to CON (17.8) at 8 h of measurement. Contrary, HPL (2.98) had higher (p<0.05) concentration of linolenic acid (LNA) compared to CON (1.03). The concentration (g/100 g FA) of c9t11 CLA was higher (p<0.05) for HPL (0.62) compared to CON (0.22). The concentration (g/100 g FA) of total CLA was also higher (p<0.05) for HPL (0.68) compared to CON (0.25) at 8 h of measurement. There were no differences (p>0.05) between treatments at 8 h of measurement in terms of other FA profiles in the blood.

Total methanogens and total protozoa population

The effect of PL on rumen methanogenic population is shown in Figure 1. The total number of methanogens (log10cell/L) in the ruminal fluid was higher (p<0.05) in CON compared to the MPL and HPL at all times of measurement.

Figure 1. Effect of PL supplementation on rumen total methanogens. See diets in Table 1. Vertical bars are standard errors of mean. Different letters denote significant differences (p<0.05).

Except at 2 h of measurement, there was no significant difference (p>0.05) among the treatments in the total number of protozoa in the ruminal fluid as shown in Figure 2. In addition, total protozoa (log10cell/mL) was highest for MPL (6.69) and HPL (7.78) at 2h of measurement and lowest at 4h of measurement; 5.91 and 5.24, respectively as compared to the other times of measurement.

Figure 2. Effect of PL supplementation on rumen total protozoa. CON (50% concentrate + 50% AH), 25% of alfalfa hay in basal diet replaced by PL (MPL) and 50% of alfalfa hay in basal diet replaced by PL (HPL). Vertical bars are standard errors of mean. Different letters denote significant differences (p<0.05).

Blood biochemical profile and antioxidant activity

The effects of PL on the blood biochemical parameters are shown in Table 4. The PL addition did not affect (p>0.05) blood biochemical parameters (glucose, urea N, total protein, uric acid cholesterol, triglycerides, HDL and LDL) of goats at 8 h.

There was a significant decrease (p<0.05) in the plasma MDA concentration (mM/mL) of PL treatment groups (2.82 and 1.33 for MPL and HPL, respectively) as compared with CON (3.33).