IntroductionTop

Fusarium head blight (FHB) of small grain cereals, caused by Fusarium graminearum Schw. (teleomorph Gibberella zeae Schw, Petch), is a global problem. This pathogen is dominant in cereal growing areas and can cause significant losses in grain yield and quality. In infected grains, the fungus may produce various mycotoxins which are harmful to humans and animals. F. graminearum is the main species producing deoxynivalenol. The reduction of yield and contamination by mycotoxin makes FHB the main cereal disease (Wilcoxson et al., 1992; Gonzalez et al., 1999; Kumar et al., 2011; Yang et al., 2013; Purahong et al., 2014; Vaughan et al., 2016; Janaviciene et al., 2018). F. avenaceum, F. culmorum, F. poae and some other less significant species may also cause FHB. However, F. graminearum species complex is the most frequently isolated species in many cereal-growing regions (Parry et al., 1995; Waalwijk et al., 2003; Xu et al., 2008). Over the last decades, this species has become prevalent in Northern Europe (Waalwijk et al., 2003; Yli-Mattila, 2010; Nielsen et al., 2012; Parikka et al., 2012; Sakalauskas et al., 2014; Suproniene et al., 2016a,b).

The host plant residues remaining in the soil are the primary source of FHB infection. Meteorological conditions, such as frequent rainfall and high relative humidity enhance the production of inoculum on the residues and increase disease prevalence for the development of FHB epidemics (Pereyra et al., 2004; Mourelos et al., 2014). Extended periods of high relative humidity (= 90%) and warm temperatures (from 15 to 30 °C) during cereal anthesis facilitate the infection of plants (De Wolf et al., 2003). Control strategies relied on breaking the disease cycle, by developing resistant host cultivars and reducing the severity of the disease through management strategies, since little can be done to manipulate the environment (Gilbert & Tekauz, 2011). The crop rotation along with non-cereals was found to reduce mycotoxin concentrations and Fusarium infestations in cereals (Bernhoft et al., 2012).

The primary host plants of F. graminearum species complex include wheat, barley, rice, oats, triticale, rye, as well as maize, in which F. graminearum may cause ear and stalk rots. Nonetheless, the disease symptoms caused by this fungus extended and recently were found and reported in some non-graminaceous crops. F. graminearum is implicated as the cause of tap-root and yellowing of sugar beet, root and seedling roots of soybean and dry rot of potato in the USA, and in root rot of pea in Canada (Ali et al., 2005; Hanson, 2006; Broders et al., 2007; Burlakoti et al., 2008; Bilgi et al., 2011). The fungus has also been isolated from several symptomless weeds (Pereyra & Dill-Macky, 2008; Mourelos et al., 2014). The observations of alternative hosts of F. graminearum have epidemiological implications in the persistence, spread and management of F. graminearum in cereals and non-cereal plants, considering they are frequently grown in crop rotation. Burlakoti et al. (2008) demonstrated substantial genetic exchange among populations of G. zeae across cereal and non-cereal hosts and across wheat cultivars. The genetic similarity among populations of F. graminearum from barley, wheat, potato and sugar beet could be part of a large overall population. Also, F. graminearum isolates from potato and sugar beet can induce additional FHB symptoms in wheat and produce different mycotoxins in wheat spikes and rice grain (Burlakoti et al., 2008; Christ et al., 2011).

Formerly, FHB used to pose minimal threat to cereals in Lithuania. An outbreak of this disease was observed only in 2012, and since then it has persisted as a severe problem (Mankeviciene et al., 2014; Suproniene et al., 2016a,b). Then, given that in Lithuania F. graminearum is a comparatively new pathogen in cereals, the ecological and epidemiological factors that play an essential role in the adaptation and survival of this fungus in the cropping systems are not yet well-defined. Variation between F. graminearum isolate aggressiveness has been observed (Purahong et al., 2014; Vaughan et al., 2016).

Therefore, in the current study, we focused on the survival of F. graminearum in cereal crop rotations during the years when cereals are not grown. The present study assesses the presence of F. graminearum species complex on non-cereal plants in the field. It also evaluates the pathogenicity of this fungus to non-cereal plants in vitro and to spring wheat under field conditions.

Material and methodsTop

Field description and study site

The research was conducted from 2015 to 2018 at the Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, in the Central part of Lithuania (55°23'50"N; 23°51'40"E). The presence of Fusarium spp. was assessed in pea, potato, rapeseed and sugar beet, grown in four subsequent cereal crop rotations established in two trials in 2015 and 2016 (Table 1).

The soil in all fields is Endocalcari-Epihypogleyic Cambisol, according to the world reference base for soil resources (WRB) classification (IUSS Working Group WRB, 2015). Soil characteristics are presented in Table 2. All fields were conventionally tilled, and crops were managed based on the common agronomic practices and individual needs (e.g., weed species, insect and disease occurrence).

Plant sampling, Fusarium spp. isolation and identification

Fifty plants per field were randomly collected in August of 2015 and 2016. The plants were taken to the laboratory, identified and processed. All the plants were visually symptomless of Fusarium spp. infection. The samples were thoroughly washed under running tap water, dried on paper towels at 20±2 ºC temperature and numbered. Then plants were divided into several segments: root, crown, stem and leaf. Samples of each plant were cut to approx. 1.0 cm size, surface-sterilised in 2% NaClO for 3 min, rinsed three times in sterile distilled water and left to dry on sterile filter paper for 30 min. Three different plant part segments were placed on potato-dextrose agar (PDA) supplemented with 50 mg/L chloramphenicol and incubated for 2-4 days at 22 ± 2ºC in the dark. The chloramphenicol permits the formation of distinctive colonies of F. graminearum (Andrews & Pitt, 1986). Fusarium colonies isolated on PDA were transferred after 3-5 days on to Spezieller Nährstoffarmer Agar (SNA) (Nirenberg, 1976), and incubated under the same conditions until the formation of a macro-conidial mass.

Spore suspensions of each isolate were spread onto 2% water agar, from which single-spore isolates were picked and subcultured on PDA and SNA. Fusarium spp. were identified as described by Leslie & Summerell (2006). Colonies showing identical features and isolated from the same plant were considered to be a single isolate. The relative density (RD) of the Fusarium species complex (expressed as percentage of species among isolates from the same genera) on non-cereal plants was calculated as follows (Gonzalez et al., 1999):

F. graminearum was re-isolated from the infected tissue to confirm infection. All isolates used in this study were morphologically identified as F. graminearum and verified by species-specific PCR, using the protocol suggested by Demeke et al. (2005) and the primer pairs Fg16F (CTCCGGATATGTTGCGTCAA) and Fg16R (GGTAGGTATCCGACATGGCAA) suggested by Nicholson et al. (1998). Using a variable number of tandem repeat (VNTR) markers (Suga et al., 2004), it was estimated that three F. graminearum isolates, 159L, 153S and 153P from wild viola (Table 3), were genetically distinct (Sneideris et al., 2018).

F. graminearum isolates

The isolates identified as F. graminearum were randomly selected for pathogenicity tests to non-cereal plants. Table 3 shows that for in vitro tests the 17 isolates selected were: 3 from wild viola (Viola arvensis), sugar beet (Beta vulgaris var. saccharifera), and pea (Pisum sativum L.); and 4 from both oilseed rape (Brassica napus L.) and potato (Solanum tuberosum L.). For field experiments the 23 isolates randomly selected were: 3 from winter wheat (Triticum aestivum L.), spring wheat, spring barley, wild viola, and oilseed rape; and 4 from both potato and pea.

Before the pathogenicity tests, F. graminearum isolates were cultured on PDA at 25 ± 2ºC for 7 days in the dark. For field spring wheat inoculation, F. graminearum isolates were grown on SNA medium at 25 ± 2°C for 7 days. Spores were washed by adding 10 mL of sterile distilled water to each 9-mm Petri dish. The concentration of spores in the suspension was counted using a Neubauer cell counting chamber. The spore concentration was adjusted to 1.0×105 spores/mL.

Host range

The pathogenicity of F. graminearum was tested on the following crop plants: faba bean (Vicia faba L.), pea, oilseed rape, sugar beet, potato and fodder beet (Beta vulgaris L. subsp. vulgaris var. crassa). Plant seeds (or potato bulbs ~2.0 cm Ø) were planted in plastic pots (Ø 10 cm) filled with a soil mix having a pH of 5.0-7.0 with 14-16-18 nitrogen, phosphorus and potassium (NKP) (Durpeta, Lithuania). One seed (or tuber) per pot was sown at 2-3 cm depth. The pots were arranged in racks in a randomised complete block design with three replicates and placed in a growth chamber at 20/16°C day/night temperature and 16-h photoperiod. Fluorescent tubes (Luxline Plus, 840 Cool White) provided light in the growth chamber (Climacell 707, MMM Medcenter Einrichtungen GmbH). The pots were watered with distilled water three times per week until the end of the experiment.

In vitro inoculation

Pathogenicity tests were conducted in three separate experiments: i) inoculation of non-cereal host plant leaves with F. graminearum from spring wheat (4vkv4); ii) inoculation of non-cereal host plant leaves with F. graminearum from wild viola (153S, 153L and 153C) and iii) inoculation of non-cereal (sugar beet, oilseed rape, pea, potato) host plant leaves with F. graminearum from same non-cereal hosts (C4, C8, C1; R2, R1, R3, R4, B42, B41, B40, B43, Z38, Z39 and Z36). All experiments were conducted in a growth chamber. Each experiment was repeated twice.

The plants were inoculated without wounding the leaf using the agar plug technique, within 2-4 weeks after planting, at the 12–13 phenological development stage of the plant (BBCH) (Gargouri-Kammoun et al., 2009). Two leaves were inoculated per plant with an agar plug (0.5 cm Ø) with mycelium, cut from the periphery of 7-day-old cultures. Five seedlings of each tested plant were inoculated with each F. graminearum isolate, in three replicates (total 15 plants per treatment). Control plants were not inoculated. Each plant was covered with a transparent plastic container. Plastic containers were removed 72 h after inoculation.

Evaluation of pathogenicity tests

Disease severity of each inoculated plant leaf was assessed 14 days post-inoculation (DPI) by calculating the percentage of leaf area affected (LAA): 1) 0% = no infection or no necrotic areas, 2) 5%, 3) 10%, 4) 25%, 5) 50% or more spots are present on the leaf (EPPO, 2002). Re-isolations of the pathogen were made from infected leaf tissue, to confirm infection by F. graminearum.

Field inoculation

For the inoculation of spring wheat cv. ‘Triso’ (moderately resistant to FHB) we selected 14 isolates (Table 3) of F. graminearum obtained from non-cereal crops: 3 isolates from oilseed rape and wild viola, 4 isolates from pea and potato; and 9 isolates from cereal crops (3 isolates from each spring wheat, winter wheat and spring barley) as positive controls. For the pathogenicity, spring wheat was grown in the crop rotation II-B after spring oilseed rape (Table 1). The floret of winter wheat was inoculated by injecting conidial suspension with an automatic pipette. Twenty microliters (10 µL/floret) of each isolate conidial suspension or sterile distilled water (negative control), were injected into two adjacent florets in the center of the spike (without wounding) at the middle of anthesis. The heads were covered to the entire spike with a polyethene bag (Fig. 1E) for 120 h to ensure constant high humidity (Purahong et al., 2014). Each treatment consisted of 20 inoculated plants (5 plants × 4 replications).

Figure 1. Symptoms of leaf discolorations caused by F. graminearum inoculation. A-D, agar plug inoculation and incubation at 20/16 °C day/night temperature and 16-h photoperiod in the growth chamber. E-F, conidial suspension injection to florets in the center of the spike. A, faba bean (7 days post-inoculation (DPI)); B, potato 7 DPI; C, D, oilseed rape 4 DPI (front and back sides, respectively); E, inoculated florets; and F, FHB symptoms in infected wheat 21 DPI.

Fusarium head blight evaluation

The FHB severity of each inoculated wheat head was evaluated after 7 (BBCH 69-71), 14 (BBCH 73) and 21 (BBCH 73-75) DPI according to the scale proposed by Engle et al. (2003). The FHB severity was used to calculate the disease progress curve (AUDPC): AUDPC=S [(Yi+1 + Yi) / 2] [ti + 1 - ti], where Yi is FHB disease severity (%) at the ith observation and ti are days of the ith observation (Madden et al., 2007).

Statistical analysis

The data were analysed with the software ANOVA, from the package SELEKCIJA (Raudonius, 2017). Before further analyses, one-way ANOVA was performed to determine if trials could be combined. The means were compared by LSD multiple range tests at the probability level of p>0.05.

ResultsTop

A total of 403 isolates of Fusarium spp. were isolated from non-cereal plants: 184 in 2015 and 219 in 2016. The proportion of Fusarium spp. isolated from non-cereal plants is presented in Table 4. All FHB-associated Fusarium species were isolated in both experimental years. The prevalence of F. graminearum and other Fusarium spp. varied, depending on the year and plant species. The RD of F. graminearum ranged between 0 and 1.7%. In 2015, F. graminearum was detected only in pea (0.5%) and sugar beet (1.7%) plants, while in 2016, it was found in all the crop rotation plant species. F. graminearum RD ranged from 0.5 to 3.7%. The highest RD (3.7%) was on potato and the lowest (0.5%) on pea and sugar beet. The RD of F. graminearum species complex was relatively low compared with other Fusarium species. In Fusarium spp. RD ranged from 19.6 to 38.5% in 2015 and from 16.4 to 28.3% in 2016.

The pathogenicity of F. graminearum species complex isolates to non-cereal plants, which are usually grown in crop rotation with cereal crops in Lithuania, was evaluated. All in vitro tested F. graminearum isolates exhibited discolouration on leaves of all plant species. At the inoculation, pinpoint lesions first appeared and enlarged brown to dark brown necrotic lesions, which, in some instances, were surrounded by a yellow chlorotic or water-soaked area (Fig. 1A-D). In all cases after re-isolation, they were morphologically confirmed as F. graminearum. Negative control plants did not show any disease symptoms.

The pathogenicity of F. graminearum isolate 4vkv4 from spring wheat was tested to evaluate its pathogenicity on non-cereal crops (Table 3). Disease severity on non-cereal plants ranged from 36.5% up to 96.9% (on average 77.0%). Pea (96.9%), fodder beet (92.5%) and faba bean (89.3%) were more susceptible to F. graminearum 4vkv4 infection than sugar beet (69.8%) and oilseed rape (36.5%) (Fig. 2).

Figure 2. Disease severity expressed as a percentage of leaf area affected (LAA) in noncereal plants inoculated with F. graminearum isolate 4vkv4 from cereal. Means followed by the same letter are not signifcantly different in each experiment (p>0.05).

F. graminearum isolates from wild viola (153S, 153L and 153C) differed in their pathogenicity to non-cereal plants. Isolate from the stem (153S) showed less infection (on average 8.1%) in pea, sugar beet and fodder beet, compared to isolates from the crown (153P, on average 17.0%) and leaf (153L, on average 13.7%) (Table 5). Contrary to the first experiment, the oilseed rape was the most susceptible to all wild viola isolates, while pea (on average 2.8%) and sugar beet (on average 6.1%) were least susceptible.

The pathogenicity of F. graminearum isolates from sugar beet, oilseed rape, pea and potato were evaluated in the same host plants. The 14 isolates caused similar F. graminearum symptoms on leaves and showed differences in disease severity and behaved differently on different host plants (Table 6). Disease severity on potato plants ranged from 16.5% up to 78.3% (on average 46.1%). The average disease severity on potato as host plant among F. graminearum isolates recovered from the same host was: potato 46.8%, pea 28.4%, sugar beet 44.8% and oilseed rape 59.6%. The isolates most pathogenic on potato plants (78.3%) were two F. graminearum from oilseed rape (R2 and R3). The pathogenicity test on pea showed that the most pathogenic (82.0%) isolate was R2, from oilseed rape (Fig. 1C), but the least pathogenic one (42.2%) was R1, another oilseed rape isolate. Disease severity on pea plants ranged from 42.2% up to 82.0% (on average 62.8%). The average disease severity in pea plants was recovered from potato (57.2%), pea (68.6%), sugar beet (64.7%) and oilseed rape (62.7%). The highest disease severity differences on pea (from 12.5% to 76.0%) were observed in F. graminearum isolates from sugar beet.

The average disease severity in sugar beet plants among F. graminearum isolates was 55.7% from oilseed rape, 55.8% from pea, 73.7% from sugar beet and 37.3% from potato. Disease severity on inoculated sugar beet plant ranged from 12.5% up to 76.0% (average of 54.3%).

The disease severity on oilseed rape plants among F. graminearum isolates was 34.3% from potato, 35.7% from pea, 25.2% from sugar beet and 44.5% from oilseed rape. Disease severity on oilseed rape plants ranged from 16.8% up to 58.5% (average 35.6%). F. graminearum pathogenicity tests indicated that all isolates were able to cause F. graminearum infection on all plant hosts but differed among the plant species (Table 6). The most pathogenic on potato and oilseed rape plants were isolates recovered from oilseed rape. However, pea and sugar beet plants were most susceptible to isolates from the same host (from pea and sugar beet).

The pathogenicity of F. graminearum isolates to spring wheat cereal was tested in the field (Table 7). All the 23 F. graminearum isolates were able to cause typical FHB symptoms in spring wheat. The infected florets were observed during the first evaluation at BBCH 69-71 (Fig. 1F). Data in Table 7 show that all isolates under field conditions were pathogenic to spring wheat cultivar ‘Triso’. No symptoms of FHB infection were detected in the negative control. The range of F. graminearum severity among the isolates causing FHB to spring wheat varied between isolates. The FHB severity ranged from 0% to 10.4% (average of 2.3%) (Table 7). AUDPC ranged from 92.0% to 264.0%. Isolate Z37 from pea caused the least disease severity and had the lowest AUDPC compared to the other isolates used in the present study. The highest FHB severity differences (from 4.0% to 10.4%, average of 6.4%) were observed among potato isolates. The most pathogenic isolate was B41 from potato. In general, all the isolates were pathogenic and caused FHB symptoms (Fig. 1F). These results suggest that F. graminearum isolates from different host plants cause FHB but differ in disease severity.

DiscussionTop

For a better understanding of F. graminearum, associated diseases in cereal and non-cereal crops were investigated. Our study demonstrated that the main FHB-associated Fusarium species occurred in the internal tissue of spring oilseed rape, pea, sugar beet and potato plants without causing visible symptoms of Fusarium spp. infection. Our results indicate that 2015-2016 was not favourable for F. graminearum development, but despite F. graminearum being the least frequently detected species, it was able to survive on all non-cereal species tested. Results show that the RD of F. graminearum was low in comparison with other Fusarium species, but despite climate change, the distribution and pathogenicity may change. Our findings illustrate that F. graminearum and other Fusarium fungi may persist in the plants mentioned above, but the lack of symptoms observed on plants suggest that the infection of these hosts by Fusarium species may be endophytic. This finding contrast with Ali et al. (2005) and Hanson (2006), who found that F. graminearum might cause distinct disease symptoms in sugar beet and potato. The FHB-related F. graminearum population is relatively ‘new’ in Lithuanian fields because the first outbreak of this pathogen was observed in 2012 and, hence, the pathogen may require more time to adapt to the new environment. However, contrary to this presumption, Harris et al. (2016) demonstrated the genomic flexibility of F. graminearum to adapt to a range of hosts. Therefore, our observations are more likely due to the relatively low amount of F. graminearum inoculum in the studied fields and insufficiently favourable environmental conditions for severe infections in non-cereal crops. Moreover, the in vitro tests of our study proved that under controlled condition all F. graminearum isolates from asympto­matic oilseed rape, pea, sugar beet and potato were able to cause disease symptoms not only on the primary host plants but also on the other non-cereal plants tested as well on wheat in the field.

The isolates of F. graminearum used in this study were found variable in their pathogenicity. The pathogenicity tests, conducted under controlled conditions, confirmed that isolates of F. graminearum, regardless of the plant from which they had been recovered (spring wheat, sugar beet, oilseed rape, pea, potato or wild viola), were able to infect faba bean, pea, sugar beet, fodder beet, oilseed rape and potato plants. The disease severity in inoculated non-cereal plants, both within isolates and host plants, varied considerably. These findings concur with previously published data (Chongo et al., 2001; Burlakoti et al., 2007; Pereyra & Dill-Macky, 2008; Ilic et al., 2012). The capability of F. graminearum isolates from FHB-infected spring wheat heads and isolates from the wild viola, oilseed rape, pea, sugar beet and potato cause necrotic and chlorotic lesions on non-cereal plant leaves, confirms that this fungus is a broad host-pathogen.

Previously F. graminearum isolated from non-cereals was considered as residue saprophyte than a pathogen (Chongo et al., 2001; Vaughan et al., 2016). The present study demonstrates an ability of F. graminearum isolates from non-cereal to cause FHB in cereals. A limitation of our data is that the isolates were tested only on a single spring wheat cultivar, but the experiment was conducted with a sufficient number of replicates. Our data indicate that all tested F. graminearum isolates were able to cause typical FHB symptoms under field conditions in spring wheat. Other researchers support this presumption, showing that F. graminearum isolates from potato, sugar beet (Burlakoti et al., 2007; Christ et al., 2011), sunflower, graminaceous weeds (Pereyra & Dill-Macky, 2008) and non-graminaceous weeds (Ilic et al., 2012) could induce the typical FHB symptoms in wheat.

The host still plays an essential role in disease development, but climate changes accompanied by biological and genetic modifications can alter ce­real susceptibility to infection and cereal-Fusarium interactions (Vaughan et al., 2016).

Based on the information generated in this study, we conclude that under congenial conditions, growing faba bean, pea, sugar beet, fodder beet, oilseed rape and potato plants in a cereal crop rotation may serve as alternative or reservoir hosts for F. graminearum pathogens. The in vitro pathogenicity test results revealed that all isolates of F. graminearum complex from spring wheat and non-cereal plants caused discolourations on leaves of faba bean, fodder beet, oilseed rape, pea, potato and sugar beet. Disease severity varied considerably among the isolates and host plants. Under field conditions, F. graminearum complex isolates from pea, potato, oilseed rape and wild viola were able to cause typical FHB symptoms in spring wheat. Considering the relatively low relative density of F. graminearum in spring rape, pea, sugar beet and potato plants in the fields, we assume that these crops are still safe to grow in cereal rotations in Lithuania. However, bearing in mind the overall information of this study and the findings obtained in other countries, we must continue to remain vigilant. Our research was focused only on F. graminearum, but as several Fusarium species may also cause FHB, it would be important to evaluate other FHB associated pathogens.