Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto al. 1, LT-58344, Akademija, Kedainiai distr., Lithuania.
Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto al. 1, LT-58344, Akademija, Kedainiai distr., Lithuania.
Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto al. 1, LT-58344, Akademija, Kedainiai distr., Lithuania.
Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto al. 1, LT-58344, Akademija, Kedainiai distr., Lithuania.
Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, Instituto al. 1, LT-58344, Akademija, Kedainiai distr., Lithuania.
Nature Research Centre, Akademijos str. 2, LT-08412, Vilnius, Lithuania.
Nature Research Centre, Akademijos str. 2, LT-08412, Vilnius, Lithuania.
Latvian Plant Protection Research Centre, Struktoru 14a, Riga, LV-1039, Latvia.
|
Abstract Fusarium graminearum, the cause of Fusarium head blight (FHB), is an important cereal pathogen. Moreover, some nongraminaceous crops are also known to be susceptible to F. graminearum infection. This study assessed the presence of F. graminearum species complex on non-cereal plants, grown in a cereal crop rotation and evaluated its pathogenicity to non-cereal plants in vitro and to spring wheat under feld conditions. The relative density of Fusarium species isolated from oilseed rape, pea, potato and sugar beet plants was assessed in 2015 and 2016. A total of 403 isolates of Fusarium spp. were obtained from non-cereal plants and only 5% of the isolates were identifed as F. graminearum. The pathogenicity test revealed that isolates of F. graminearum from spring wheat and noncereal plants caused discolourations on leaves of faba bean, fodder beet, oilseed rape, pea, potato and sugar beet. The pea was the crop most susceptible to F. graminearum isolated from spring wheat. The pathogenicity of F. graminearum from sugar beet, oilseed rape, pea and potato to the same hosts differed depending on isolate and inoculated plant. Under feld conditions, F. graminearum isolates from pea, potato, oilseed rape and wild viola were able to cause typical FHB symptoms in spring wheat. Based on the information generated in this study, we conclude that under congenial conditions, growing faba bean, pea, sugar beet, fodder beet, oilseed rape and potato plants in a cereal crop rotation may serve as alternative or reservoir hosts for F. graminearum pathogens. Additional keywords: Beta vulgaris var. saccharifera; Brassica napus; pathogenicity; Pisum sativum; Solanum tuberosum; Viola arvensis. Abbreviations used: AUDPC (disease progress curve); BBCH (phenological development stage of the plant); DPI (days post inoculation); FHB (Fusarium head blight); LAA (leaf area affected); NKP (nitrogen, phosphorus and potassium); PCR (polymerase chain reaction); PDA (potato-dextrose agar medium); RD (relative density); SNA (Spezieller Nährstoffarmer agar medium). Authors' contributions: All authors performed the experiments. Collected the feld samples: OT, SK and GK. Collected data: JK PS, SK & NR. Molecular analysis: DS & AI. Data analysis, and interpretation of the data: NR & SK. Coordinating the research project and obtaining funding: GK. Drafting and critical revision of the manuscript: NR, GK & SK. Citation: Rasiukeviciute, N.; Suproniene, S.; Kelpsiene, J.; Svegzda, P.; Kadziene, G.; Sneideris, D.; Ivanauskas, A.; Treikale, O. (2018). Susceptibility of non-cereal crops to Fusarium graminearum complex and their role within cereal crop rotation as a source of inoculum for Fusarium head blight. Spanish Journal of Agricultural Research, Volume 16, Issue 4, e1012. https://doi.org/10.5424/sjar/2018164-13952 Received: 16 Sep 2018. Accepted: 10 Dec 2018. Copyright © 2018 INIA. This is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC-by 4.0) License. Funding: Lithuanian Research Council, National Research Program “Sustainability of agro-, forest and water ecosystems” (Grant No. SIT-05/2015). Competing interests: The authors have declared that no competing interests exist. Correspondence should be addressed to Neringa Rasiukeviciute: n.rasiukeviciute@lsdi.lt |
|
CONTENTS |
Fusarium head blight (FHB) of small grain cereals, caused by Fusarium graminearum Schw. (teleomorph Gibberella zeae Schw, Petch), is a global problem. This pathogen is dominant in cereal growing areas and can cause significant losses in grain yield and quality. In infected grains, the fungus may produce various mycotoxins which are harmful to humans and animals. F. graminearum is the main species producing deoxynivalenol. The reduction of yield and contamination by mycotoxin makes FHB the main cereal disease (Wilcoxson et al., 1992; Gonzalez et al., 1999; Kumar et al., 2011; Yang et al., 2013; Purahong et al., 2014; Vaughan et al., 2016; Janaviciene et al., 2018). F. avenaceum, F. culmorum, F. poae and some other less significant species may also cause FHB. However, F. graminearum species complex is the most frequently isolated species in many cereal-growing regions (Parry et al., 1995; Waalwijk et al., 2003; Xu et al., 2008). Over the last decades, this species has become prevalent in Northern Europe (Waalwijk et al., 2003; Yli-Mattila, 2010; Nielsen et al., 2012; Parikka et al., 2012; Sakalauskas et al., 2014; Suproniene et al., 2016a,b).
The host plant residues remaining in the soil are the primary source of FHB infection. Meteorological conditions, such as frequent rainfall and high relative humidity enhance the production of inoculum on the residues and increase disease prevalence for the development of FHB epidemics (Pereyra et al., 2004; Mourelos et al., 2014). Extended periods of high relative humidity (= 90%) and warm temperatures (from 15 to 30 °C) during cereal anthesis facilitate the infection of plants (De Wolf et al., 2003). Control strategies relied on breaking the disease cycle, by developing resistant host cultivars and reducing the severity of the disease through management strategies, since little can be done to manipulate the environment (Gilbert & Tekauz, 2011). The crop rotation along with non-cereals was found to reduce mycotoxin concentrations and Fusarium infestations in cereals (Bernhoft et al., 2012).
The primary host plants of F. graminearum species complex include wheat, barley, rice, oats, triticale, rye, as well as maize, in which F. graminearum may cause ear and stalk rots. Nonetheless, the disease symptoms caused by this fungus extended and recently were found and reported in some non-graminaceous crops. F. graminearum is implicated as the cause of tap-root and yellowing of sugar beet, root and seedling roots of soybean and dry rot of potato in the USA, and in root rot of pea in Canada (Ali et al., 2005; Hanson, 2006; Broders et al., 2007; Burlakoti et al., 2008; Bilgi et al., 2011). The fungus has also been isolated from several symptomless weeds (Pereyra & Dill-Macky, 2008; Mourelos et al., 2014). The observations of alternative hosts of F. graminearum have epidemiological implications in the persistence, spread and management of F. graminearum in cereals and non-cereal plants, considering they are frequently grown in crop rotation. Burlakoti et al. (2008) demonstrated substantial genetic exchange among populations of G. zeae across cereal and non-cereal hosts and across wheat cultivars. The genetic similarity among populations of F. graminearum from barley, wheat, potato and sugar beet could be part of a large overall population. Also, F. graminearum isolates from potato and sugar beet can induce additional FHB symptoms in wheat and produce different mycotoxins in wheat spikes and rice grain (Burlakoti et al., 2008; Christ et al., 2011).
Formerly, FHB used to pose minimal threat to cereals in Lithuania. An outbreak of this disease was observed only in 2012, and since then it has persisted as a severe problem (Mankeviciene et al., 2014; Suproniene et al., 2016a,b). Then, given that in Lithuania F. graminearum is a comparatively new pathogen in cereals, the ecological and epidemiological factors that play an essential role in the adaptation and survival of this fungus in the cropping systems are not yet well-defined. Variation between F. graminearum isolate aggressiveness has been observed (Purahong et al., 2014; Vaughan et al., 2016).
Therefore, in the current study, we focused on the survival of F. graminearum in cereal crop rotations during the years when cereals are not grown. The present study assesses the presence of F. graminearum species complex on non-cereal plants in the field. It also evaluates the pathogenicity of this fungus to non-cereal plants in vitro and to spring wheat under field conditions.
Field description and study site
The research was conducted from 2015 to 2018 at the Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, in the Central part of Lithuania (55°23'50"N; 23°51'40"E). The presence of Fusarium spp. was assessed in pea, potato, rapeseed and sugar beet, grown in four subsequent cereal crop rotations established in two trials in 2015 and 2016 (Table 1).
Table 1. Crop rotations (I, II, III and IV) and felds (A, B) selected for plant sampling.
The soil in all fields is Endocalcari-Epihypogleyic Cambisol, according to the world reference base for soil resources (WRB) classification (IUSS Working Group WRB, 2015). Soil characteristics are presented in Table 2. All fields were conventionally tilled, and crops were managed based on the common agronomic practices and individual needs (e.g., weed species, insect and disease occurrence).
Table 2. Soil characteristics of experimental felds.
Plant sampling, Fusarium spp. isolation and identification
Fifty plants per field were randomly collected in August of 2015 and 2016. The plants were taken to the laboratory, identified and processed. All the plants were visually symptomless of Fusarium spp. infection. The samples were thoroughly washed under running tap water, dried on paper towels at 20±2 ºC temperature and numbered. Then plants were divided into several segments: root, crown, stem and leaf. Samples of each plant were cut to approx. 1.0 cm size, surface-sterilised in 2% NaClO for 3 min, rinsed three times in sterile distilled water and left to dry on sterile filter paper for 30 min. Three different plant part segments were placed on potato-dextrose agar (PDA) supplemented with 50 mg/L chloramphenicol and incubated for 2-4 days at 22 ± 2ºC in the dark. The chloramphenicol permits the formation of distinctive colonies of F. graminearum (Andrews & Pitt, 1986). Fusarium colonies isolated on PDA were transferred after 3-5 days on to Spezieller Nährstoffarmer Agar (SNA) (Nirenberg, 1976), and incubated under the same conditions until the formation of a macro-conidial mass.
Spore suspensions of each isolate were spread onto 2% water agar, from which single-spore isolates were picked and subcultured on PDA and SNA. Fusarium spp. were identified as described by Leslie & Summerell (2006). Colonies showing identical features and isolated from the same plant were considered to be a single isolate. The relative density (RD) of the Fusarium species complex (expressed as percentage of species among isolates from the same genera) on non-cereal plants was calculated as follows (Gonzalez et al., 1999):
F. graminearum was re-isolated from the infected tissue to confirm infection. All isolates used in this study were morphologically identified as F. graminearum and verified by species-specific PCR, using the protocol suggested by Demeke et al. (2005) and the primer pairs Fg16F (CTCCGGATATGTTGCGTCAA) and Fg16R (GGTAGGTATCCGACATGGCAA) suggested by Nicholson et al. (1998). Using a variable number of tandem repeat (VNTR) markers (Suga et al., 2004), it was estimated that three F. graminearum isolates, 159L, 153S and 153P from wild viola (Table 3), were genetically distinct (Sneideris et al., 2018).
Table 3. The origin of isolates of Fusarium graminearum used for pathogenicity tests.
F. graminearum isolates
The isolates identified as F. graminearum were randomly selected for pathogenicity tests to non-cereal plants. Table 3 shows that for in vitro tests the 17 isolates selected were: 3 from wild viola (Viola arvensis), sugar beet (Beta vulgaris var. saccharifera), and pea (Pisum sativum L.); and 4 from both oilseed rape (Brassica napus L.) and potato (Solanum tuberosum L.). For field experiments the 23 isolates randomly selected were: 3 from winter wheat (Triticum aestivum L.), spring wheat, spring barley, wild viola, and oilseed rape; and 4 from both potato and pea.
Before the pathogenicity tests, F. graminearum isolates were cultured on PDA at 25 ± 2ºC for 7 days in the dark. For field spring wheat inoculation, F. graminearum isolates were grown on SNA medium at 25 ± 2°C for 7 days. Spores were washed by adding 10 mL of sterile distilled water to each 9-mm Petri dish. The concentration of spores in the suspension was counted using a Neubauer cell counting chamber. The spore concentration was adjusted to 1.0×105 spores/mL.
Host range
The pathogenicity of F. graminearum was tested on the following crop plants: faba bean (Vicia faba L.), pea, oilseed rape, sugar beet, potato and fodder beet (Beta vulgaris L. subsp. vulgaris var. crassa). Plant seeds (or potato bulbs ~2.0 cm Ø) were planted in plastic pots (Ø 10 cm) filled with a soil mix having a pH of 5.0-7.0 with 14-16-18 nitrogen, phosphorus and potassium (NKP) (Durpeta, Lithuania). One seed (or tuber) per pot was sown at 2-3 cm depth. The pots were arranged in racks in a randomised complete block design with three replicates and placed in a growth chamber at 20/16°C day/night temperature and 16-h photoperiod. Fluorescent tubes (Luxline Plus, 840 Cool White) provided light in the growth chamber (Climacell 707, MMM Medcenter Einrichtungen GmbH). The pots were watered with distilled water three times per week until the end of the experiment.
In vitro inoculation
Pathogenicity tests were conducted in three separate experiments: i) inoculation of non-cereal host plant leaves with F. graminearum from spring wheat (4vkv4); ii) inoculation of non-cereal host plant leaves with F. graminearum from wild viola (153S, 153L and 153C) and iii) inoculation of non-cereal (sugar beet, oilseed rape, pea, potato) host plant leaves with F. graminearum from same non-cereal hosts (C4, C8, C1; R2, R1, R3, R4, B42, B41, B40, B43, Z38, Z39 and Z36). All experiments were conducted in a growth chamber. Each experiment was repeated twice.
The plants were inoculated without wounding the leaf using the agar plug technique, within 2-4 weeks after planting, at the 12–13 phenological development stage of the plant (BBCH) (Gargouri-Kammoun et al., 2009). Two leaves were inoculated per plant with an agar plug (0.5 cm Ø) with mycelium, cut from the periphery of 7-day-old cultures. Five seedlings of each tested plant were inoculated with each F. graminearum isolate, in three replicates (total 15 plants per treatment). Control plants were not inoculated. Each plant was covered with a transparent plastic container. Plastic containers were removed 72 h after inoculation.
Evaluation of pathogenicity tests
Disease severity of each inoculated plant leaf was assessed 14 days post-inoculation (DPI) by calculating the percentage of leaf area affected (LAA): 1) 0% = no infection or no necrotic areas, 2) 5%, 3) 10%, 4) 25%, 5) 50% or more spots are present on the leaf (EPPO, 2002). Re-isolations of the pathogen were made from infected leaf tissue, to confirm infection by F. graminearum.
Field inoculation
For the inoculation of spring wheat cv. ‘Triso’ (moderately resistant to FHB) we selected 14 isolates (Table 3) of F. graminearum obtained from non-cereal crops: 3 isolates from oilseed rape and wild viola, 4 isolates from pea and potato; and 9 isolates from cereal crops (3 isolates from each spring wheat, winter wheat and spring barley) as positive controls. For the pathogenicity, spring wheat was grown in the crop rotation II-B after spring oilseed rape (Table 1). The floret of winter wheat was inoculated by injecting conidial suspension with an automatic pipette. Twenty microliters (10 µL/floret) of each isolate conidial suspension or sterile distilled water (negative control), were injected into two adjacent florets in the center of the spike (without wounding) at the middle of anthesis. The heads were covered to the entire spike with a polyethene bag (Fig. 1E) for 120 h to ensure constant high humidity (Purahong et al., 2014). Each treatment consisted of 20 inoculated plants (5 plants × 4 replications).
|
|
Fusarium head blight evaluation
The FHB severity of each inoculated wheat head was evaluated after 7 (BBCH 69-71), 14 (BBCH 73) and 21 (BBCH 73-75) DPI according to the scale proposed by Engle et al. (2003). The FHB severity was used to calculate the disease progress curve (AUDPC): AUDPC=S [(Yi+1 + Yi) / 2] [ti + 1 - ti], where Yi is FHB disease severity (%) at the ith observation and ti are days of the ith observation (Madden et al., 2007).
Statistical analysis
The data were analysed with the software ANOVA, from the package SELEKCIJA (Raudonius, 2017). Before further analyses, one-way ANOVA was performed to determine if trials could be combined. The means were compared by LSD multiple range tests at the probability level of p>0.05.
A total of 403 isolates of Fusarium spp. were isolated from non-cereal plants: 184 in 2015 and 219 in 2016. The proportion of Fusarium spp. isolated from non-cereal plants is presented in Table 4. All FHB-associated Fusarium species were isolated in both experimental years. The prevalence of F. graminearum and other Fusarium spp. varied, depending on the year and plant species. The RD of F. graminearum ranged between 0 and 1.7%. In 2015, F. graminearum was detected only in pea (0.5%) and sugar beet (1.7%) plants, while in 2016, it was found in all the crop rotation plant species. F. graminearum RD ranged from 0.5 to 3.7%. The highest RD (3.7%) was on potato and the lowest (0.5%) on pea and sugar beet. The RD of F. graminearum species complex was relatively low compared with other Fusarium species. In Fusarium spp. RD ranged from 19.6 to 38.5% in 2015 and from 16.4 to 28.3% in 2016.
Table 4. Relative density of Fusarium species on noncereal plants in 2015 and 2016.
The pathogenicity of F. graminearum species complex isolates to non-cereal plants, which are usually grown in crop rotation with cereal crops in Lithuania, was evaluated. All in vitro tested F. graminearum isolates exhibited discolouration on leaves of all plant species. At the inoculation, pinpoint lesions first appeared and enlarged brown to dark brown necrotic lesions, which, in some instances, were surrounded by a yellow chlorotic or water-soaked area (Fig. 1A-D). In all cases after re-isolation, they were morphologically confirmed as F. graminearum. Negative control plants did not show any disease symptoms.
The pathogenicity of F. graminearum isolate 4vkv4 from spring wheat was tested to evaluate its pathogenicity on non-cereal crops (Table 3). Disease severity on non-cereal plants ranged from 36.5% up to 96.9% (on average 77.0%). Pea (96.9%), fodder beet (92.5%) and faba bean (89.3%) were more susceptible to F. graminearum 4vkv4 infection than sugar beet (69.8%) and oilseed rape (36.5%) (Fig. 2).
|
|
F. graminearum isolates from wild viola (153S, 153L and 153C) differed in their pathogenicity to non-cereal plants. Isolate from the stem (153S) showed less infection (on average 8.1%) in pea, sugar beet and fodder beet, compared to isolates from the crown (153P, on average 17.0%) and leaf (153L, on average 13.7%) (Table 5). Contrary to the first experiment, the oilseed rape was the most susceptible to all wild viola isolates, while pea (on average 2.8%) and sugar beet (on average 6.1%) were least susceptible.
Table 5. Percentage of leaf area affected (LAA) in noncereal plants, inoculated with Fusarium graminearum isolates 153S, 153L and 153C recovered from Viola arvensis.
The pathogenicity of F. graminearum isolates from sugar beet, oilseed rape, pea and potato were evaluated in the same host plants. The 14 isolates caused similar F. graminearum symptoms on leaves and showed differences in disease severity and behaved differently on different host plants (Table 6). Disease severity on potato plants ranged from 16.5% up to 78.3% (on average 46.1%). The average disease severity on potato as host plant among F. graminearum isolates recovered from the same host was: potato 46.8%, pea 28.4%, sugar beet 44.8% and oilseed rape 59.6%. The isolates most pathogenic on potato plants (78.3%) were two F. graminearum from oilseed rape (R2 and R3). The pathogenicity test on pea showed that the most pathogenic (82.0%) isolate was R2, from oilseed rape (Fig. 1C), but the least pathogenic one (42.2%) was R1, another oilseed rape isolate. Disease severity on pea plants ranged from 42.2% up to 82.0% (on average 62.8%). The average disease severity in pea plants was recovered from potato (57.2%), pea (68.6%), sugar beet (64.7%) and oilseed rape (62.7%). The highest disease severity differences on pea (from 12.5% to 76.0%) were observed in F. graminearum isolates from sugar beet.
Table 6. Disease severity expressed as a percentage of leaf area affected (means ± standard errors) in pea, sugar beet, oilseed rape and potato plants inoculated with Fusarium graminearum recovered from the same hosts.
The average disease severity in sugar beet plants among F. graminearum isolates was 55.7% from oilseed rape, 55.8% from pea, 73.7% from sugar beet and 37.3% from potato. Disease severity on inoculated sugar beet plant ranged from 12.5% up to 76.0% (average of 54.3%).
The disease severity on oilseed rape plants among F. graminearum isolates was 34.3% from potato, 35.7% from pea, 25.2% from sugar beet and 44.5% from oilseed rape. Disease severity on oilseed rape plants ranged from 16.8% up to 58.5% (average 35.6%). F. graminearum pathogenicity tests indicated that all isolates were able to cause F. graminearum infection on all plant hosts but differed among the plant species (Table 6). The most pathogenic on potato and oilseed rape plants were isolates recovered from oilseed rape. However, pea and sugar beet plants were most susceptible to isolates from the same host (from pea and sugar beet).
The pathogenicity of F. graminearum isolates to spring wheat cereal was tested in the field (Table 7). All the 23 F. graminearum isolates were able to cause typical FHB symptoms in spring wheat. The infected florets were observed during the first evaluation at BBCH 69-71 (Fig. 1F). Data in Table 7 show that all isolates under field conditions were pathogenic to spring wheat cultivar ‘Triso’. No symptoms of FHB infection were detected in the negative control. The range of F. graminearum severity among the isolates causing FHB to spring wheat varied between isolates. The FHB severity ranged from 0% to 10.4% (average of 2.3%) (Table 7). AUDPC ranged from 92.0% to 264.0%. Isolate Z37 from pea caused the least disease severity and had the lowest AUDPC compared to the other isolates used in the present study. The highest FHB severity differences (from 4.0% to 10.4%, average of 6.4%) were observed among potato isolates. The most pathogenic isolate was B41 from potato. In general, all the isolates were pathogenic and caused FHB symptoms (Fig. 1F). These results suggest that F. graminearum isolates from different host plants cause FHB but differ in disease severity.
Table 7. The pathogenicity (means ± standard errors) of Fusarium graminearum isolates from non-cereal and cereal hosts to spring wheat, 2017.
For a better understanding of F. graminearum, associated diseases in cereal and non-cereal crops were investigated. Our study demonstrated that the main FHB-associated Fusarium species occurred in the internal tissue of spring oilseed rape, pea, sugar beet and potato plants without causing visible symptoms of Fusarium spp. infection. Our results indicate that 2015-2016 was not favourable for F. graminearum development, but despite F. graminearum being the least frequently detected species, it was able to survive on all non-cereal species tested. Results show that the RD of F. graminearum was low in comparison with other Fusarium species, but despite climate change, the distribution and pathogenicity may change. Our findings illustrate that F. graminearum and other Fusarium fungi may persist in the plants mentioned above, but the lack of symptoms observed on plants suggest that the infection of these hosts by Fusarium species may be endophytic. This finding contrast with Ali et al. (2005) and Hanson (2006), who found that F. graminearum might cause distinct disease symptoms in sugar beet and potato. The FHB-related F. graminearum population is relatively ‘new’ in Lithuanian fields because the first outbreak of this pathogen was observed in 2012 and, hence, the pathogen may require more time to adapt to the new environment. However, contrary to this presumption, Harris et al. (2016) demonstrated the genomic flexibility of F. graminearum to adapt to a range of hosts. Therefore, our observations are more likely due to the relatively low amount of F. graminearum inoculum in the studied fields and insufficiently favourable environmental conditions for severe infections in non-cereal crops. Moreover, the in vitro tests of our study proved that under controlled condition all F. graminearum isolates from asymptomatic oilseed rape, pea, sugar beet and potato were able to cause disease symptoms not only on the primary host plants but also on the other non-cereal plants tested as well on wheat in the field.
The isolates of F. graminearum used in this study were found variable in their pathogenicity. The pathogenicity tests, conducted under controlled conditions, confirmed that isolates of F. graminearum, regardless of the plant from which they had been recovered (spring wheat, sugar beet, oilseed rape, pea, potato or wild viola), were able to infect faba bean, pea, sugar beet, fodder beet, oilseed rape and potato plants. The disease severity in inoculated non-cereal plants, both within isolates and host plants, varied considerably. These findings concur with previously published data (Chongo et al., 2001; Burlakoti et al., 2007; Pereyra & Dill-Macky, 2008; Ilic et al., 2012). The capability of F. graminearum isolates from FHB-infected spring wheat heads and isolates from the wild viola, oilseed rape, pea, sugar beet and potato cause necrotic and chlorotic lesions on non-cereal plant leaves, confirms that this fungus is a broad host-pathogen.
Previously F. graminearum isolated from non-cereals was considered as residue saprophyte than a pathogen (Chongo et al., 2001; Vaughan et al., 2016). The present study demonstrates an ability of F. graminearum isolates from non-cereal to cause FHB in cereals. A limitation of our data is that the isolates were tested only on a single spring wheat cultivar, but the experiment was conducted with a sufficient number of replicates. Our data indicate that all tested F. graminearum isolates were able to cause typical FHB symptoms under field conditions in spring wheat. Other researchers support this presumption, showing that F. graminearum isolates from potato, sugar beet (Burlakoti et al., 2007; Christ et al., 2011), sunflower, graminaceous weeds (Pereyra & Dill-Macky, 2008) and non-graminaceous weeds (Ilic et al., 2012) could induce the typical FHB symptoms in wheat.
The host still plays an essential role in disease development, but climate changes accompanied by biological and genetic modifications can alter cereal susceptibility to infection and cereal-Fusarium interactions (Vaughan et al., 2016).
Based on the information generated in this study, we conclude that under congenial conditions, growing faba bean, pea, sugar beet, fodder beet, oilseed rape and potato plants in a cereal crop rotation may serve as alternative or reservoir hosts for F. graminearum pathogens. The in vitro pathogenicity test results revealed that all isolates of F. graminearum complex from spring wheat and non-cereal plants caused discolourations on leaves of faba bean, fodder beet, oilseed rape, pea, potato and sugar beet. Disease severity varied considerably among the isolates and host plants. Under field conditions, F. graminearum complex isolates from pea, potato, oilseed rape and wild viola were able to cause typical FHB symptoms in spring wheat. Considering the relatively low relative density of F. graminearum in spring rape, pea, sugar beet and potato plants in the fields, we assume that these crops are still safe to grow in cereal rotations in Lithuania. However, bearing in mind the overall information of this study and the findings obtained in other countries, we must continue to remain vigilant. Our research was focused only on F. graminearum, but as several Fusarium species may also cause FHB, it would be important to evaluate other FHB associated pathogens.
|
Ali S, Rivera VV, Seco GA, 2005. First report of Fusarium graminearum causing dry rot of potato in North Dakota. Plant Dis 89: 105. https://doi.org/10.1094/PD-89-0105B Andrews S, Pitt JI, 1986. Selective medium for isolation of Fusarium species and dematiaceous hyphomycetes from cereals. Appl Environ Microbiol 51 (6): 1235-1238. Bernhoft A, Torp M, Clasen PE, Løes AK, Kristoffersen AB, 2012. Influence of agronomic and climatic factors on Fusarium infestation and mycotoxin contamination of cereals in Norway. Food Addit Contam 29 (7): 1129-1140. https://doi.org/10.1080/19440049.2012.672476 Bilgi VN, Bradley CA, Mathew FM, Ali S, Rasmussen JB, 2011. Root rot of dry edible bean caused by Fusarium graminearum. Plant Health Progress online. https://doi.org/10.1094/PHP-2011-0425-01-RS Broders KD, Lipps PE, Paul PA, Dorrance AE, 2007. Evaluation of Fusarium graminearum associated with corn and soybean seed and seedling disease in Ohio. Plant Dis 91: 1155-1160. https://doi.org/10.1094/PDIS-91-9-1155 Burlakoti RR, Estrada R, Rivera VV, Boddeda A, Secor GA, Adhikari TB, 2007. Real-time PCR quantification and mycotoxin production of Fusarium graminearum in wheat inoculated with isolates collected from potato, sugar beet and wheat. Phytopathology 97: 835-841. https://doi.org/10.1094/PHYTO-97-7-0835 Burlakoti RR, Ali S, Secor GA, Neate SM, McMullen MP, Adhikari TB, 2008. Genetic relationships among populations of Gibberella zeae from barley, wheat, potato, and sugar beet in the Upper Midwest of the United States. Phytopathology 98: 969-976. https://doi.org/10.1094/PHYTO-98-9-0969 Chongo G, Gossen BD, Kutcher HR, Gilbert J, Turkington TK, Fernandez MR, McLaren D, 2001. Reaction of seedling roots of 14 crop species to Fusarium graminearum from wheat heads. Can J Plant Pathol 23 (2): 132-137. https://doi.org/10.1080/07060660109506920 Christ DS, Gödecke R, von Tiedemann A, Varrelmann M, 2011. Pathogenicity, symptom development, and mycotoxin formation in wheat by Fusarium species frequently isolated from sugar beet. Phytopathology 101 (11): 1338-1345. https://doi.org/10.1094/PHYTO-01-11-0003 De Wolf ED, Madden LV, Lipps PE. 2003. Risk assessment models for wheat Fusarium head blight epidemics based on within-season weather data. Phytopathology 93: 428-435. https://doi.org/10.1094/PHYTO.2003.93.4.428 Demeke T, Clear RM, Patrick SK, Gaba D, 2005. Species-specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. Int J Food Microbiol 103: 271-284. https://doi.org/10.1016/j.ijfoodmicro.2004.12.026 Engle JS, Lipps PE, Mills D, 2003. Fusarium head blight severity scale for winter wheat. Ohio State University Extension Fact Sheet. Bulletin AC-48-03. EPPO, 2002. Efficacy evaluation of fungicides: Root, stem, foliar and pod diseases of rape. EPPO PP 1/78 (3): 100-105. Gargouri-Kammoun L, Gargouri S, Rezgui S, Trifi M, Bahri N, Hajlaoui MR, 2009. Pathogenicity and aggressiveness of Fusarium and Microdochium on wheat seedlings under controlled conditions. Tunis J Plant Prot 4: 135-144. Gilbert J, Tekauz A, 2011. Strategies for management of fusarium head blight (FHB) in cereals. PS&C Prairie Soils & Crops Journal 4: 97-104. Gonzalez HHL, Martinez EJ, Pacin A, Resnik SL, 1999. Relationship between Fusarium graminearum and Aspergillus alternata contamination and deoxynivalenol occurrence of Argentinian durum wheat. Mycopathologia 144: 97-102. https://doi.org/10.1023/A:1007020822134 Hanson LE, 2006; Fusarium yellowing of sugar beet caused by Fusarium graminearum from Minnesota and Wyoming. Plant Dis 90: 686. https://doi.org/10.1094/PD-90-0686A Harris LJ, Balcerzak M, Johnston A, Schneiderman D, Ouellet T; 2016; Host-preferential Fusarium graminearum gene expression during infection of wheat, barley, and maize. Fungal Biol 120 (1): 111-123. https://doi.org/10.1016/j.funbio.2015.10.010 Ilic J, Cosic J, Jurkovic D, Vrandecic K, 2012. Pathogenicity of Fusarium spp. isolated from weeds and plant debris in eastern Croatia to wheat and maize. Poljoprivreda/Agriculture 18: 7-11. IUSS Working Group WRB, 2015. World Reference Base for soil resources 2014, update 2015. International soil classification system for naming soils and creating legends for soil maps. World Soil Resources Report No. 106. FAO, Rome. 193 pp. Janaviciene S, Mankeviciene A, Suproniene S, Kochiieru Y, Keriene I, 2018. The prevalence of deoxynivalenol and its derivatives in the spring wheat grain from different agricultural production systems in Lithuania. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 35 (6): 1179-1188. https://doi.org/10.1080/19440049.2018.1427893 Kumar K, Xi K, Turkington TK, Tekauz A, Helm JH, Tewari JP, 2011. Evaluation of a detached leaf assay to measure fusarium head blight resistance components in barley. Can J Plant Pathol 33 (3): 364-374. https://doi.org/10.1080/07060661.2011.590820 Leslie JF, Summerell BA, 2006. The Fusarium laboratory manual. Blackwell Publ Prof, Ames, IA, USA. 388 pp. https://doi.org/10.1002/9780470278376 Madden LV, Hughes G, van den Bosch F, 2007. The study of plant disease epidemics. APS Press, St. Paul, MN, USA. 432 pp. Mankeviciene A, Jablonskyte-Rašce D, Maikšteniene S, 2014. Occurence of mycotoxins in spelt and common wheat grain and their products. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 31 (1): 132-138. https://doi.org/10.1080/19440049.2013.861614 Mourelos CA, Malbran PA, Ghiringhelli PD, Lori GA, 2014. Gramineous and non-gramineous weed species as alternative hosts of Fusarium graminearum, causal agent of Fusarium head blight of wheat, in Argentina. Crop Prot 65: 100-104. https://doi.org/10.1016/j.cropro.2014.07.013 Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D, 1998. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol Mol Plant Pathol 53 (1): 17-37. https://doi.org/10.1006/pmpp.1998.0170 Nielsen LK, Jensen JD, Rodríguez A, Jørgensen LN, Justesen AF, 2012. TRI12 based quantitative real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. Int J Food Microbiol 157: 384-392. https://doi.org/10.1016/j.ijfoodmicro.2012.06.010 Nirenberg HI, 1976. Untersuchungen über die morphologische und biologisch Diffrenzieerum in der Fusarium Sekion Lisiola. Mitteilungen der Biologischen Bundesanstalt für Land- und Forstwirtschaft 169: 1-117. Parikka P, Hakala K, Tiilikkala K, 2012. Expected shifts in Fusarium species' composition on cereal grain in Northern Europe due to climatic change. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 29 (10): 1543-1555. https://doi.org/10.1080/19440049.2012.680613 Parry DW, Jenkinson P, Mc Leod L, 1995. Fusarium ear blight in small grain cereals-a review. Plant Pathol 44: 207-238. https://doi.org/10.1111/j.1365-3059.1995.tb02773.x Pereyra SA, Dill-Macky R, Sims AL, 2004. Survival and inoculum production of Gibberella zeae in wheat residue. Plant Dis 88: 724-730. https://doi.org/10.1094/PDIS.2004.88.7.724 Pereyra SA, Dill-Macky R, 2008. Colonisation of residues of diverse plant species by Gibberella zeae and their contribution to Fusarium head blight inoculum. Plant Dis 92: 800-807. https://doi.org/10.1094/PDIS-92-5-0800 Purahong W, Nipoti P, Pisi A, Lemmens M, Prodi A, 2014. Aggressiveness of different Fusarium graminearum chemotypes within a population from Northern-Central Italy. Mycoscience 55 (1): 63-69. https://doi.org/10.1016/j.myc.2013.05.007 Raudonius S, 2017. Application of statistics in plant and crop research: important issues. Zemdirbyste-Agriculture 104 (4): 377-382. https://doi.org/10.13080/z-a.2017.104.048 Sakalauskas S, Stumbriene K, Suproniene S, Svegzda P, 2014. Changes in Fusarium link species composition from Lithuanian wheat grain in years 2005-2007 to 2011-2013. Proc Latv Acad Sci B Nat Exact Appl Sci 32 (1): 45-50. https://doi.org/10.2478/plua-2014-0013 Sneideris D, Ivanauskas A, Suproniene S, Kadziene G, Sakalauskas S, 2018. Genetic diversity of Fusarium graminearum isolated from weeds. Eur J Plant Pathol.https://doi.org/10.1007/s10658-018-1543-3 Suga H, Gale LR, Kistler C, 2004. Development of VNTR markers for two Fusarium graminearum clade species. Mol Ecol Notes 4: 468-470. https://doi.org/10.1111/j.1471-8286.2004.00703.x Suproniene S, Sakalauskas S, Mankeviciene A, Barcauskaite K, Jonaviciene A, 2016a. Distribution of B type trichothecene producing Fusarium species in wheat grain and relation to mycotoxins DON and NIV concentrations. Zemdirbyste-Agriculture 103 (3): 281-288. https://doi.org/10.13080/z-a.2016.103.036 Suproniene S, Sakalauskas S, Stumbriene K, Zvirdauskiene R, Svegzda P, 2016b. Variances in trichothecene chemotype distribution in Lithuanian wheat grain and within pure culture Fusarium graminearum isolated from the same grain samples. Eur J Plant Pathol 144: 371-381. https://doi.org/10.1007/s10658-015-0774-9 Vaughan M, Backhouse D, Del Ponte EM, 2016. Climate change impacts on the ecology of Fusarium graminearum species complex and susceptibility of wheat to Fusarium head blight: A review. World Mycotoxin J 9 (5): 685-700. https://doi.org/10.3920/WMJ2016.2053 Waalwijk C, Kastelein P, de Vries I, Kerényi Z, van der Lee T, Hesselink T, Köhl J, Kema G, 2003. Major changes in Fusarium spp. in wheat in the Netherlands. Eur J Plant Pathol 109 (7): 743-754. https://doi.org/10.1023/A:1026086510156 Wilcoxson RD, Busch RH, Ozmon EA, 1992. Fusarium head blight resistance in spring wheat cultivars. Plant Dis 76 (7): 658-661. https://doi.org/10.1094/PD-76-0658 Xu XM, Nicholson P, Thomsett MA, Simpson D, Cooke BM, Doohan FM, Brennan J, Monaghan S, Moretti A, Mule G, et al., 2008. Relationship between the fungal complex causing Fusarium head blight of wheat and environmental conditions. Phytopathology 98 (1): 69-78. https://doi.org/10.1094/PHYTO-98-1-0069 Yang F, Jacobsen S, Jørgensen HJL, Collinge DB, Svensson B, Finnie C, 2013. Fusarium graminearum and its interactions with cereal heads: studies in the proteomics era. Front Plant Sci 37 (4): 1-8. https://doi.org/10.3389/fpls.2013.00037 Yli-Mattila T, 2010. Ecology and evolution of toxigenic Fusarium species in cereals in Northern Europe and Asia. J Plant Pathol 92: 7-18. |