Institute of Agro-Food Research and Technology (IRTA). Ctra. de Cabrils s/n, 08348 Cabrils, Barcelona, Spain.
Agrofood Laboratory, Department of Agriculture, Food, and Rural Action, Generalitat de Catalunya. 08348 Barcelona, Spain.
Agricultural Sciences (CCA), Federal University of Santa Catarina. 88040-970 Florianopolis, SC, Brazil.
Institute of Agro-Food Research and Technology (IRTA). Ctra. de Cabrils s/n, 08348 Cabrils, Barcelona, Spain.
|
Abstract Lavender species form the arbuscular mycorrhizal symbiosis and are at the same time highly susceptible to white root rot. In an attempt to evaluate the response of mycorrhizal Lavandula angustifolia L. to Armillaria mellea (Vahl:Fr) P. Kumm in a greenhouse experiment, plants were previously inoculated with an isolate of the arbuscular mycorrhizal fungus Rhizophagus irregularis (former Glomus intraradices BEG 72) and the influence of the pH growing medium on the plant-symbiont-pathogen interaction was tested in gnotobiotic autotrophic growth systems in which mycorrhizal inoculum was obtained from root organ cultures. After ten months growth dual-inoculated lavender plants grown in containers with a pasteurized substrate mixture produced a similar number of spikes than healthy plants and achieved equivalent plant diameter coverage. When the growing medium in the autotrophic systems was supplemented with calcium carbonate, the inoculation of lavender plantlets with R. irregularis at higher pH (7.0 and 8.5) media caused a significant decrease of A. mellea presence in plant roots, as detected by qPCR. Moreover, the observation of internal root mycorrhizal infection showed that the extent of mycorrhizal colonization increasedin plant rootsgrown at higher pH, indicating that tolerance to white root rot in lavender plants inoculated with R. irregularis could be associated to mycorrhizal establishment. Additional key words: white root rot; control strategies; Glomus intraradices; Lavandula angustifolia; pH; Rhizophagus irregularis. Abbreviations used: AMF (arbuscular mycorrhizal fungi); MSR (Strullu-Romand medium); qPCR (real-time PCR); ROC (root organ culture). Citation: Calvet, C.; Garcia-Figueres, F.; Lovato, P.; Camprubi, A. (2015). Role of the arbuscular mycorrhizal symbiosis in tolerance response against Armillaria mellea in lavender. Spanish Journal of Agricultural Research, Volume 13, Issue 3, e1008, 8 pages. http://dx.doi.org/10.5424/sjar/2015133-7677. Received: 09 Mar 2015. Accepted: 07 Jul 2015 Copyright © 2015 INIA. This is an open access article distributed under the Creative Commons Attribution License (CC by 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Funding: Spanish Ministry of Economy and Competitiveness, MINECO (Grant AGL 2010-15017). Paulo Lovato was supported by Fundaçao Capes, Brazilian Ministry of Education. Competing interests: The authors have declared that no competing interests exist. Correspondence should be addressed to Cinta Calvet: cinta.calvet@irta.cat |
|
CONTENTS |
Lavender species native of the western Mediterranean are the most economically important among herb crops due to their versatile use in phytochemical industries. They are commercially grown for essential oil extraction and as perennial drought-tolerant woody shrubs they are also used in restoration and sustainable ornamental landscaping activities. Lavender forms the arbuscular mycorrhizal symbiosis, and benefits of plant inoculation with selected fungi have been reported by several authors (Azcón & Barea, 1997; Bakkali-Yakhlef et al., 2011; Karagiannidis et al., 2012).
Arbuscular mycorrhizal fungi (AMF), present in natural soils and undisturbed ecosystems, develop their life cycle in association with the roots of most terrestrial plant species, being the most common symbiosis between plant and fungi. The positive effects of AMF on host plant development and health have been extensively documented, with a special emphasis on improvement of plant nutrition (Jeffries & Barea, 2001), on adaptation to extreme environmental conditions (Bashan et al., 2012), and on interactions with plant pathogens (Azcón-Aguilar et al., 2002; Pozo & Azcón-Aguilar, 2007).
As most woody shrubs, lavender is highly susceptible to white root rot, a fungal disease caused by Armillaria spp. that seriously damages agricultural production, especially in replant soils (Lis-Balchin, 2012). The basidiomycete genus Armillaria is recognized as the first cause of the replant syndrome in dry calcareous Mediterranean soils, infecting woody crops, such as fruit trees, grapevines and olive trees, leading to high economic losses (Gur & Cohen, 1989; Westphal et al., 2002; Vossen, 2007). Armillaria species colonize living host roots during a parasitic phase, but can survive in dead wood tissue in their saprophytic phase, which can last for decades. This explains why soil infestation is extremely difficult to eradicate, while effective control measures are lacking (Rizzo et al., 1998). The fungal mycelium destroys the vascular tissue of primary roots and root crowns, causing poor nutrient uptake, decreased vigor, often leading to plant death (Rishbeth, 1985).
Woody shrubs infected by Armillaria develop root and crown damage identical to those occurring in fruit trees and grapevines (Lis-Balchin, 2012). However, lavender plants are more easily managed, and for this reason, L. angustifolia was chosen as a mycorrhizal model plant for autotrophic culture systems. Such systems allow to study interactions between both fungi, symbiont and pathogen, and to perform molecular assessment of A. mellea in inoculated roots.
The objective of this work was to test the early establishment of the symbiosis in lavender plants through inoculation with selected AMF as a control strategy against Armillaria by evaluating the response of mycorrhizal Lavandula angustifolia L. to a strongly virulent Armillaria mellea (Vahl: Fr) P. Kumm isolate in two different experiments. Plants were inoculated with both types of fungi, mutualistic and pathogenic, under controlled conditions in a greenhouse, in order to record growth parameters and fungal colonization in vivo. Additionally, the influence of increasing medium pH through CaCO3 supplies on the plant-symbiont-pathogen interaction was evaluated in a gnotobiotic autotrophic growth system that allows quantifying the effects of external factors.
Greenhouse experiment
The first experiment was set up in a greenhouse under controlled conditions (23±5ºC) with 32 plants equally distributed in four treatments in a 2 × 2 factorial design, consisting of non mycorrhizal plants inoculated or not with A. mellea and mycorrhizal plants inoculated or not with A. mellea. Lavandula angustifolia plants (10±2 cm height) obtained from rooted cuttings were inoculated with Rhizophagus irregularis (former Glomus intraradices BEG 72) [(Blaszk., Wubet, Renker & Buscot) C Walker & A Shüssler comb nov], a native AMF from Spain originally isolated from Citrus (Camprubi & Calvet, 1996) with proven effectiveness in different agricultural systems involving root pathogens infestations (Calvet et al., 2001; Camprubi et al., 2008). Plants were placed in 2-liter containers filled with a mixture of pasteurized sandy soil, sphagnum peat and quartz sand (3:2:1; v/v/v) of pH 7.7. Each container in the mycorrhizal treatments received 10 mL of R. irregularis bulk inoculum obtained from leek (Allium porrum L.) cultures, containing spores (at least 1000 spores in 10 mL) and colonized root fragments. The inoculum was placed below the plant root systems at planting.
The Armillaria isolate was obtained from a heavily infested peach (Prunus persica L.) replant orchard. It was molecularly identified as A. mellea (Mansilla et al., 2000), grown in pure cultures on malt agar, and used to inoculate autoclaved chestnuts (Castanea sativa L) in sterile malt agar medium (Difco®) supplemented with 0.2 g/L streptomycine sulphate and 10 mL/L benomyl. After a 5-month incubation period at 25ºC in the dark, infected chestnuts were used as individual sources of pathogenic inoculum.
One month after the mycorrhizal inoculation, lavender plants were placed in an open-air shade house and each container of the pathogen-inoculated treatments received one infected chestnut, placed at 10-cm depth and 10-cm distance from the plant stem. Fertilization was applied every two weeks (10 mL Hoagland’s nutrient solution per plant). Plants were harvested after ten months, when decay symptoms were apparent on the plants. Plants were cut to measure shoot and root weights, largest plant diameter and number of spikes. The extent of mycorrhizal root colonization was measured in plants inoculated with R. irregularis and A. mellea damage was estimated in the root system of pathogen-inoculated plants. In order to assess R. irregularis internal infection, root samples from each inoculated plant were clarified and stained (Phillips & Hayman, 1980) and the percentage of root colonized by the mycorrhizal fungus was measured with the gridline intersect method (Giovannetti & Mosse, 1980). Disease symptoms caused by A. mellea were recorded in plants that had received the infected chestnuts. Two levels of root necrosis and crown necrosis were determined: “High” (infection ranking from 25% to 100% of the root system length) and “Low” (infected root below 25%) for root necrosis; “High” (necrotic tissue with presence of white mycelium) and “Low” (necrotic tissue with no mycelium) for crown necrosis.
Data obtained for plant growth were analyzed in a multifactorial ANOVA and means were compared by Tukey’s test when there was no interaction between factors: pathogen and mycorrhiza.
In vitro experiment
In order to evaluate the interaction between R. irregularis and A. mellea, in medium with different calcium (Ca) levels, L. angustifolia plantlets were used to establish mycorrhizal autotrophic culture systems described by Voets et al. (2005). In such systems, the plant leaves perform photosynthesis while roots grow axenically inside a petri plate filled with modified Strullu-Romand medium (MSR) with no sugar or vitamins (Voets et al., 2005) and 7 g agar/L. Under such conditions, the root can be colonized by an AMF monoxenically grown on Agrobacterium rhizogenes-transformed roots in a root organ culture (ROC) (Declerck et al., 1996). In our experiment, the procedure followed to obtain the tripartite association (lavender plant-AMF-root rot fungus) was basically the same described by Nogales et al. (2010) for grapevine plants. Since the amount of growing medium in a 100 mm petri plate was insufficient to sustain grapevine growth longer than a week, requiring the system to be refilled periodically, which increased the risk of contaminations, we used 350-mL autoclaved plastic containers, in order to avoid unnecessary manipulation (Lovato et al., 2014). Lavandula angustifolia seeds were surface-sterilized in 32% sodium hypochlorite for 30 min and thoroughly washed with sterile distilled water three consecutive times for 10 min. The seeds were germinated on sterilized filter paper in petri plates at 25ºC in the dark, and plantlets with incipient roots were transferred to sterilized glass pots (Le pratique®) containing 150 mL of Murashige Skoog (MS) (Murashige & Skoog, 1962) medium with vitamins (Duchefa Biochemie) and supplemented with 30 g/L saccharose and 7 g/L agar (Difco). Plants were grown for 10 weeks in a growth chamber at 25ºC and 16 h photoperiod (200 µmol/m2/s).
The same four treatments described in the greenhouse experiment were adopted for the in vitro experiment: non mycorrhizal plants inoculated or not with A. mellea and mycorrhizal plants inoculated or not with A. mellea. The containers not inoculated with A. mellea were directly filled with 350 mL of modified MSR medium.
In A. mellea treatments, 80 mL of MSR medium were first poured into the containers, cooled and solidified (Lovato et al., 2014). Two 7-mm diameter plugs of A. mellea mycelium from a pure culture were inserted in the medium after removing agar plugs which were replaced afterwards. Each container received then 270 mL of the same modified MSR medium, previously cooled at 40ºC. An incision was made on the lid of the container, through which a lavender plant was inserted, in order to keep the shoot outside the container and the root inside the growing medium. At the same time, the inoculation with the AMF in mycorrhizal treatments was performed using a six-month old ROC culture in a bi-compartmented dish of R. irregularis (Nogales et al., 2010). Two 1-cm2 plugs containing 100 to 150 mycorrhizal spores were excised from the compartment lacking roots and introduced next to the root tips, following the same procedure used for A. mellea plugs. Once both inoculations were completed, the container was carefully closed, the space around the stem in the incision hole was sealed with sterile silicone (Panreac) and parafilm was wrapped around the lid.
In order to evaluate the effects of pH, the growing medium in the container was supplemented with increasing levels of CaCO3 (Panreac): 0, 100 mg/L and 3000 mg/L, which resulted in different pH values of 5.5, 7.0 and 8.5, respectively. There were eight replicates for each pH treatment, and lavender autotrophic systems were placed in a growth chamber at 25ºC.
After nine weeks plants were harvested, shoot dry weight and root fresh weight were recorded, and morphological symptoms of A. mellea infection were observed. Root samples were excised in order to estimate mycorrhizal colonization after clarifying and staining (see the greenhouse experiment) and to quantify A. mellea by real-time PCR (qPCR).
For quantification of the pathogenic fungus 1.0 g root samples were separated and ground in mortar and pestle with liquid nitrogen. Genomic DNA was extracted from a 70-100-mg (fresh weight) sample of ground roots with phytoplasma grinding buffer (PGB) (Arhens & Seemüller, 1992). Specific primers designed by Baumgartner et al. (2010) to amplify a fungal gene for the nuclear elongation factor subunit 1-alpha, EF1a-F1 (5GGATGGCACGGTGATAACAT) and EF1a-R1 5AGTCTTGCCCTTGACGACAC), were used to amplify a 150-bp section of the EF1a gene.
Real-time PCR was carried out using the Step One™ Instrument (Life Technologies) and the SYBR® Premier Ex Taq™ kit (Takara, Shiga, Japan). We used a 25 µL reaction volume containing the following components: 12.5 µL SYBR green Super mix, 1 µL of each forward/reverse (F/R) primers (10 µM), 2 µL DNA templates (20 ng/L of DNA), 8 µL sterile HPLC water and 0.5 µL ROX reference dye. Triplicate reactions were routinely used for each sample and each set included controls containing water to check for contamination in the reaction components. The qPCR cycling program was: 10 min at 95°C, followed by 40 cycles at 95°C for 15 s, 60°C for 45 s, and a dissociation stage with 15 s at 95°C, 30 s at 60°C and 15 s at 95°C. The qPCR signal was calibrated by making a standard curve with DNA extracted by the previously described method from known amounts of mycelium from a pure A. mellea culture. The cycle threshold (Ct) was calculated for all the standards and samples to indicate the number of cycles required for the fluorescence signal to cross the threshold above background during the exponential PCR amplification phase. DNA quantities were adjusted for the amount of root material used.
Greenhouse experiment
The A. mellea isolate used was highly virulent: five out of eight non-mycorrhizal plants infected by A. mellea were dead at harvest, while all mycorrhizal plants survived and showed less severe disease symptoms (Table 1). None of the mycorrhizal lavender plants showed a high level of necrotic root tissue and only one among them attained a high level of crown necrosis. The presence of A. mellea in R. irregularis-inoculated roots had no significant effect on the root system mycorrhizal colonization extent, that reached mean values of 36±14 % in plants inoculated only with the mutualistic fungus and 29±12% in plants with the dual inoculation. Growth parameters measured at harvest (Fig. 1) indicated that both the AM fungus and the pathogen had significant effects on lavender growth. The effect of mycorrhizal inoculation was highly significant at increasing shoot biomass and plant shoot diameter. Infection by A. mellea lowered shoot biomass and the number of spikes produced at flowering. However, dual inoculated lavender plants were capable to overcome root-rot infection, as there were no significant differences in the number of spikes produced by mycorrhizal plants inoculated with the pathogen (Fig. 1) and by healthy plants. Additionally, they reached the same plant diameter coverage than mycorrhizal plants not infected with the pathogen.
Table 1. Estimation of white root rot Armillaria mellea disease symptoms at harvest in Lavandula angustifolia plants inoculated and non-inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis ten months after inoculation with the pathogen
|
|
In vitro experiment
Armillaria mellea was detected by qPCR only in part of the plants inoculated with R. irregularis. For instance, the pathogenic fungus was detected only in one out of eight mycorrhizal plants grown in pH 7.0 medium and in none of the mycorrhizal plants grown in pH 8.5 medium. Consequently, the quantification analysis was discarded and a contingency analysis of chi-square values followed by Pearson’s test (JMP® 8.0.1 SAS) was used to analyze the effect of mycorrhizal inoculation with R. irregularis on the detection of A. mellea in lavender roots grown in autotrophic systems.
There were significant differences in Armillaria detection due to AM fungal inoculation when substrate pH was increased by CaCO3 addition (Table 2). At pH 5.5 A. mellea was detected in equal amounts in mycorrhizal and non-mycorrhizal plants, since more than 70% of the plants from both treatments were positive for the pathogen’s presence. When plants grew in higher pH media, detection of A. mellea decreased only in mycorrhizal plants. The percentage of detection in dual-inoculated plants grown in pH 7.0 medium was only 17, and it was null in plants grown in medium with pH 8.5. Differences in A. mellea detection due to pH values were significant according to Pearson’s test (p=0.0036) only for plants inoculated with both fungi, R. irregularis and the pathogen. On the other hand, growth medium pH in autotrophic systems had no significant influence on the detection of A. mellea in non-mycorrhizal plants (Table 2).
Table 2. Detection of Armillaria mellea by qPCR in the roots of Lavandula angustifolia plants grown in autotrophic culture systems with three different medium pH values, inoculated or non-inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis
Mycorrhizal plants grown in pH 5.5 medium without A. mellea had only 34±3 % of the plant root system colonized by the mycorrhizal fungus (Table 3), while this percentage attained 61±3 % at pH 8.5. The value for dual inoculated plants was similar, as 25±12 % of the root system was mycorrhizal in plants grown in 5.5 pH medium, while in plants grown in pH 8.5 medium this index was 66±23 %. Armillaria mellea infection had no effect on mycorrhizal root colonization after 10 weeks. The percentages of mycorrhizal colonization in plants inoculated with the AMF or with both fungi were similar (34±3 vs 25±12) and (61±3 vs 66±23) at pH 5.5 and pH 8.5 respectively.
Table 3. Mycorrhizal colonization extent by Rhizophagus irregularis in roots of Lavandula angustifolia plants grown in autotrophic culture systems with three different medium pH values, inoculated or non-inoculated with Armillaria mellea
Rhizophagus irregularis BEG 72 applied as bulk inoculum in container-grown lavender plants was very effective as plant growth stimulator, as reported before for other host plant species, both under controlled conditions and in field trials in which the fungus had been introduced in plant production systems (Estaún et al., 2003; Camprubi et al., 2008; Nogales et al., 2009). Moreover, results obtained in the greenhouse experiment showed that mycorrhizal early inoculation with this selected AMF isolated from a high-pH soil in southern Catalonia (Camprubi & Calvet, 1996) alleviated the deleterious effect of the root rot fungus on container-grown lavender plants. Despite A. mellea infection, mycorrhizal plants showed high flowering potential, as shown by higher number of spikes, and achieved biomass and plant diameter equivalent to those of mycorrhizal plants not challenged by the pathogen. Plant survival, flower production, and soil coverage surface are all important characteristics for crop production and for revegetation that benefit from early mycorrhizal inoculation, even when the growth substrate is infested by A. mellea. Those results suggest that higher level of mycorrhizal inoculation may be an advantage when using lavender plants, either for production or for revegetation, in Armillaria-infested soils.
AMF-induced tolerance to pathogens and pests has been observed in several plant species (Calvet et al., 2001; Pozo et al., 2002; Elsharkawy et al., 2012; Schausberger et al., 2012) and the protection mechanisms involved are subject of research (Pineda et al., 2013; Torres-Vera et al., 2014). Using an in vitro system to study the interaction between white root rot infection caused by A. mellea and Glomus intraradices in the grapevine rootstock 110 Richter, Nogales et al. (2010) showed a decrease in disease symptoms in mycorrhizal plants, confirming that the root colonization by a mycorrhizal fungus increased tolerance to white root rot, as reported in vineyard trials with mycorrhizal plants conducted by the same authors (Camprubi et al., 2008; Nogales et al., 2009). The AMF Glomus mosseae lowered mortality by Fusarium in basil (Ocimum basilicum L.), a plant species from the same family as lavender, and that effect was not related to P contents, which were similar in non-mycorrhizal and mycorrhizal plants (Toussaint et al., 2008). A meta-analysis work by Veresoglou et al. (2013) showed that N fertilization increases severity of pathogen damage, with no effect from P or K fertilization, but their publication sample does not include any study regarding effects of calcium or pH. Heyman et al. (2007) showed that increased Ca content, but not higher soil pH, increased prevalence and severity of Aphanomyces in pea. Calcium and pH had no effect on mortality caused by Armillaria ostoyae (Mallett & Maynard, 1998) and on the other hand higher soil pH increased the severity of Armillaria attacks on forest trees (McLaughlin et al., 2011), but those works were performed with the ectomycorrhizal species red pine and lodgepole pine, respectively.
Lavender plants grew well in the autotrophic systems and colonization patterns by both R. irregularis and A. mellea were easily established in vitro using ROC mycorrhizal inoculum and pure cultures of the pathogenic isolate. When the effects of interaction between root-rot fungus and AMF were evaluated in autotrophic plant growing systems, the inoculation of lavender plantlets with R. irregularis at higher pH media caused a significant decrease of A. mellea presence in plant roots, as detected by qPCR. At the same time, the extent of mycorrhizal colonization increased when the medium was supplemented with CaCO3, indicating that the growth medium pH affected the percentage of root colonized by R. irregularis. The growth conditions were more suitable for the AMF isolate according to the characteristics of the soil of origin (Camprubi & Calvet, 1996), as pointed out for the effect of soil pH on mycorrhizal fungi efficiency (Hayman & Tavares, 1985). In fact, A. mellea was detected in more than 70% of the plants, irrespectively of mycorrhizal inoculation, at pH 5.5, but only in non-mycorrhizal plants (almost 60%) in medium with pH 8.5, showing that R. irregularis protection effect against A. mellea was associated with mycorrhizal establishment.
Results obtained in the molecular detection of A. mellea in the autotrophic systems are in accordance with those obtained in the dual inoculated lavender plants tested in vivo. Detection by qPCR is a quick experimental test that proved suitable to evaluate the effect of plant mycorrhizal inoculation and the influence of an external factor, such as the pH of the growing medium modified by CaCO3, on the interaction between both microorganisms. This methodology could be very useful when assessing the belowground infective potential of A. mellea in field grown lavender plants.
Authors thank J Parladé for helpful discussion and assistance in statistics.
| ○ | Arhens U, Seemüller E, 1992. Detection of DNA of plant pathogenic mycoplasmalike organisms by a polymerase chain-reaction that amplifies a sequence of the 16S RNA gene. Phytopathology 82: 828-832. http://dx.doi.org/10.1094/Phyto-82-828 |
| ○ | Azcón R, Barea JM, 1997. Mycorrhizal dependency of a representative plant species in Mediterranean shrublands (Lavandula spica L.) as a key factor to its use for revegetation strategies in desertification-threatened areas. Appl Soil Ecol 7: 83-92. http://dx.doi.org/10.1016/S0929-1393(97)00013-9 |
| ○ | Azcón-Aguilar C, Jaizme-Vega M, Calvet C, 2002. The contribution of arbuscular mycorrhizas to the control of soilborne plant pathogens. In: Mycorrhizal technology in agriculture: from genes to bioproducts; Gianinazzi S, Schüepp H, Barea JM, Haselwandter K (eds). Birkhaüser, Basel, Switzerland. http://dx.doi.org/10.1007/978-3-0348-8117-3_15 |
| ○ | Bakkali-Yakhlef S, Abbas Y, Prin Y, Abourouh M, Perrineau MM, Duponnois R, 2011. Effective arbuscular mycorrhizal fungi in the roots of Tetraclinis articulata and Lavandula multifida in moroccan Tetraclinis woodlands. Mycology 2: 79-86. http://dx.doi.org/10.1080/21501203. 2011.565486 |
| ○ | Bashan Y, Salazar BG, Moreno M, López BR, Linderman RG, 2012. Restoration of eroded soil in the Sonoran desert with native leguminous trees using plant growth promoting microorganisms and limited amounts of compost and water. J Environ Manage 102: 26-36. http://dx.doi.org/10.1016/j.jenvman.2011.12.032 |
| ○ | Baumgartner K, Bhat R, Fujiyoshi P, 2010. A rapid infection assay for Armillaria and real-time PCR quantitation of the fungal biomass in planta. Fungal Biol 114: 107-119. http://dx.doi.org/10.1016/j.mycres.2009.11.003 |
| ○ | Calvet C, Pinochet J, Hernández-Dorrego A, Estaún V, Camprubi A, 2001. Field microplot performance of the peach-almond hybrid GF 677 after inoculation with arbuscular mycorrhizal fungi in a replant soil infested with root-knot nematodes. Mycorrhiza 10: 295-300. http://dx.doi.org/10.1007/PL00009998 |
| ○ | Camprubi A, Calvet C, 1996. Isolation and screening of mycorrhizal fungi from citrus nurseries and orchards and inoculation studies. HortScience 31: 366-369. |
| ○ | Camprubi A, Estaún V, Nogales A, García-Figueres F, Pitet M, Calvet C, 2008. Response of the grapevine rootstock Richter 110 to inoculation with native and selected arbuscular mycorrhizal fungi and growth performance in a replant vineyard. Mycorrhiza 18: 211-216. http://dx.doi.org/10.1007/s00572-008-0168-3 |
| ○ | Declerck S, Strullu DG, Plenchette C, 1996. In vitro mass-production of the arbuscular mycorrhizal fungus, Glomus versiforme associated with Ri T-DNA transformed carrot roots. Mycol Res 100: 1237-1242. http://dx.doi.org/10.1016/S0953-7562(96)80186-9 |
| ○ | Estaún V, Camprubi A, Calvet C, Pinochet J, 2003. Nursery and field response of olive trees inoculated with two arbuscular mycorrhizal fungi, Glomus intraradices and Glomus mosseae. J Am Soc Hort Sci 128: 767-775. |
| ○ | Elsharkawy MM, Shimizu M, Takahashi H, Hyakumachi M, 2012. The plant growth-promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae induce systemic resistance against Cucumber mosaic virus in cucumber plants. Plant Soil http://dx.doi.org/10.1007/s11104-012-1255-y |
| ○ | Giovannetti M, Mosse B, 1980. An evaluation of techniques for measuring vesicular-arbuscular mycorrhizal infection in roots. New Phytologist 87: 489-500. http://dx.doi.org/10.1111/j.1469-8137.1980.tb04556.x |
| ○ | Gur A, Cohen Y, 1989. The peach replant problem-some causal agents. Soil Biol Biochem 21: 829-834. http://dx.doi.org/10.1016/0038-0717(89)90177-6 |
| ○ | Hayman DS, Tavares M, 1985. Influence of soil-pH on the symbiotic efficiency of different endophytes. New Phytologist 100: 367-377. http://dx.doi.org/10.1111/j.1469-8137.1985.tb02786.x |
| ○ | Heyman F, Lindahl B, Persson L, Wikstrom M, Stenlid J, 2007. Calcium concentrations of soil affect suppressiveness against Aphanomyces root rot of pea. Soil Biol Biochem 39: 2222-2229. http://dx.doi.org/10.1016/j.soilbio.2007.03.022 |
| ○ | Jeffries P, Barea JM, 2001. Arbuscular mycorrhiza: A key component of sustainable plant-soil ecosystems. In: The Mycota. Vol. 9. Fungal associations; Hock B (ed). pp: 95-113. Springer-Verlag, Berlin. http://dx.doi.org/10.1007/978-3-662-07334-6_6 |
| ○ | Karagiannidis N, Thomidis T, Panou-Filotheou E, 2012. Effects of Glomus lamellosum on growth, essential oil production and nutrients uptake in selected medicinal plants. J Agric Sci 4: 137-144. |
| ○ | Lis-Balchin, 2012. Lavender. In: Handbook of herbs and spices, 2nd edition; Peter KV (ed). Woodhead Publ., Cambridge, UK. |
| ○ | Lovato PE, Garcia-Figueres F, Camprubi A, Parladé J, Calvet C, 2014. A semiaxenic phototrophic system to study interactions between arbuscular mycorrhizal and pathogenic fungi in woody plants. Eur J Plant Pathol 140: 207-212. http://dx.doi.org/10.1007/s10658-014-0468-8 |
| ○ | Mallett KI, Maynard DG, 1998. Armillaria root disease, stand characteristics, and soil properties in young lodgepole pine. Forest Ecol Manage 105: 37-44. http://dx.doi.org/10.1016/S0378-1127(97)00294-6 |
| ○ | Mansilla JP, Aguín O, Abelleira A, Saínz MJ, 2000. Adaptación de la reacción en cadena de la polimerasa (PCR) para la identificación de especies de Armillaria en Galicia. Bol San Veg Plagas 62: 79-88. |
| ○ | McLaughlin JA, Hsiang T, Hayden G, Greifenhagen S, 2011. Abiotic and biotic factors used to assess decline risk in red pine (Pinus resinosa Ait.) plantations. Forest Chron 87: 99-115. http://dx.doi.org/10.5558/tfc87099-1 |
| ○ | Murashige T, Skoog F, 1962. A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol plantarum 15: 473-497. http://dx.doi.org/10.1111/j.1399-3054.1962.tb08052.x |
| ○ | Nogales A, Luque J, Estaún V, Camprubi A, Garcia-Figueres F, Calvet C, 2009. Differential growth of mycorrhizal field-inoculated grapevine rootstocks in two replant soils. Am J Enol Viticult 60: 484-489. |
| ○ | Nogales A, Camprubi A, Estaún V, Marfá V, Calvet C, 2010. In vitro interaction studies between Glomus intraradices and Armillaria mellea in vines. Span J Agric Res 8 (S1): S62-S68. http://dx.doi.org/10.5424/sjar/201008S1-1223 |
| ○ | Phillips JM, Hayman DS, 1980. Improved procedures for clearing roots and staining parasitic and vesicular arbuscular mycorrhizal fungi for rapid assessment of infection. Trans Br Mycol Soc 55: 158-161. http://dx.doi.org/10.1016/S0007-1536(70)80110-3 |
| ○ | Pineda A, Dicke M, Pieterse CMJ, Pozo MJ, 2013. Beneficial microbes in a changing environment: are they always helping plants to deal with insects? Funct Ecol 27: 574-586. http://dx.doi.org/10.1111/1365-2435.12050 |
| ○ | Pozo MJ, Cordier C, Dumas-Gaudot E, Gianinazzi S, Azcón-Aguilar C, Barea JM, 2002. Localized vs systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophtora infection in tomato plants. J Exp Bot 53: 525-534. http://dx.doi.org/10.1093/jexbot/53.368.525 |
| ○ | Pozo MJ, Azcón-Aguilar C, 2007. Unravelling mycorrhiza induced resistance. Curr Opin Plant Biol 10: 393-398. http://dx.doi.org/10.1016/j.pbi.2007.05.004 |
| ○ | Rishbeth J, 1985. Infection cycle of Armillaria and host response. Eur J Forest Pathol 15: 332-341. http://dx.doi.org/10.1111/j.1439-0329.1985.tb01108.x |
| ○ | Rizzo DM, Whiting EC, Elkins RB, 1998. Spatial distribution of Armillaria mellea in pear orchards. Plant Dis 82: 1226-1231. http://dx.doi.org/10.1094/PDIS.1998.82.11.1226 |
| ○ | Schausberger P, Peneder S, Jürschik S, Hoffmann D, 2012. Mycorrhiza changes plant volatiles to attract spider mite enemies. Funct Ecol 26: 441-449. http://dx.doi.org/10.1111/j.1365-2435.2011.01947.x |
| ○ | Torres-Vera R, García JM, Pozo MJ, López-Ráez JA, 2014. Do strigolactones contribute to plant defence? Mol Plant Pathol 15: 211-216. http://dx.doi.org/10.1111/mpp.12074 |
| ○ | Toussaint JP, Kraml M, Nell M, Smith SE, Smith FA, Steinkellner S, Schmiderer C, Vierheilig H, Novak J, 2008. Effect of Glomus mosseae on concentrations of rosmarinic and caffeic acids and essential oil compounds in basil inoculated with Fusarium oxysporum f.sp. basilica. Plant Pathol 57: 1109-1115. http://dx.doi.org/10.1111/j.1365-3059.2008.01895.x |
| ○ | Veresoglou SD, Bart EK, Menexes G, Rillig MC, 2013. Fertilization affects severity of disease caused by fungal plant pathogens. Plant Pathol 62: 961-969. http://dx.doi.org/10.1111/ppa.12014 |
| ○ | Voets L, Boulois HD, Renard L, Strullu DG, Declerck S, 2005. Development of an autotrophic culture system for the in vitro mycorrhization of potato plants. FEMS Microbiol 248: 111-118. http://dx.doi.org/10.1016/j.femsle.2005.05.025 |
| ○ | Vossen PM, 2007. Organic olive production manual. Publication 3505, University of California, USA. |
| ○ | Westphal A, Browne GT, Schneider S, 2002. Evidence for biological nature of grapevine replant problem in California. Plant Soil 242: 197-203. http://dx.doi.org/10.1023/A:1016297603427 |